ID: 1027138147

View in Genome Browser
Species Human (GRCh38)
Location 7:75639071-75639093
Sequence GGGGGGGTGCCCCGCAGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027138147_1027138160 15 Left 1027138147 7:75639071-75639093 CCGAGGCTGCGGGGCACCCCCCC No data
Right 1027138160 7:75639109-75639131 GCTTCCCCCAAAGCTGCTCCCGG 0: 1
1: 0
2: 1
3: 20
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027138147 Original CRISPR GGGGGGGTGCCCCGCAGCCT CGG (reversed) Intronic