ID: 1027139735

View in Genome Browser
Species Human (GRCh38)
Location 7:75648631-75648653
Sequence CCCCTAAGCTGCCGGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027139725_1027139735 18 Left 1027139725 7:75648590-75648612 CCAGGTGCACCCCCAGAACCTTT 0: 1
1: 0
2: 0
3: 24
4: 183
Right 1027139735 7:75648631-75648653 CCCCTAAGCTGCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1027139728_1027139735 7 Left 1027139728 7:75648601-75648623 CCCAGAACCTTTCCATTCTGCAT 0: 1
1: 0
2: 1
3: 15
4: 248
Right 1027139735 7:75648631-75648653 CCCCTAAGCTGCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1027139726_1027139735 9 Left 1027139726 7:75648599-75648621 CCCCCAGAACCTTTCCATTCTGC 0: 1
1: 0
2: 1
3: 25
4: 281
Right 1027139735 7:75648631-75648653 CCCCTAAGCTGCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1027139730_1027139735 0 Left 1027139730 7:75648608-75648630 CCTTTCCATTCTGCATGATAGAC 0: 1
1: 0
2: 1
3: 14
4: 126
Right 1027139735 7:75648631-75648653 CCCCTAAGCTGCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1027139729_1027139735 6 Left 1027139729 7:75648602-75648624 CCAGAACCTTTCCATTCTGCATG 0: 1
1: 0
2: 0
3: 15
4: 222
Right 1027139735 7:75648631-75648653 CCCCTAAGCTGCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1027139727_1027139735 8 Left 1027139727 7:75648600-75648622 CCCCAGAACCTTTCCATTCTGCA 0: 1
1: 0
2: 3
3: 35
4: 319
Right 1027139735 7:75648631-75648653 CCCCTAAGCTGCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 78
1027139731_1027139735 -5 Left 1027139731 7:75648613-75648635 CCATTCTGCATGATAGACCCCCT 0: 1
1: 1
2: 0
3: 4
4: 93
Right 1027139735 7:75648631-75648653 CCCCTAAGCTGCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027139735 Original CRISPR CCCCTAAGCTGCCGGAAGTC AGG Intronic
900630239 1:3631245-3631267 CCCCAGAGCTGCCTCAAGTCAGG + Intronic
902592584 1:17485648-17485670 ACCCTAAGCTGCTGGAAGCCTGG + Intergenic
902725739 1:18334885-18334907 CCCCCAGGCTGCCCGAGGTCCGG + Exonic
903421959 1:23224513-23224535 CCCCTTTGTTGCGGGAAGTCAGG - Intergenic
916290404 1:163159485-163159507 CCCCTCTGTTGCGGGAAGTCAGG - Intronic
920988266 1:210911124-210911146 GACCTAAGCTGCTTGAAGTCTGG + Intronic
922532418 1:226354572-226354594 CCCCACAGCTGCAGGAAGGCTGG - Intergenic
1069936875 10:71923609-71923631 ACCCTGAGCTGCTGGAAATCAGG + Intergenic
1071290316 10:84184379-84184401 CACCTAAGCTGCCTTAGGTCTGG - Intronic
1072983591 10:100120207-100120229 CCCTTAAGCTCCCGGAGGGCTGG - Intergenic
1073267408 10:102236197-102236219 CCCCCAAACTGCTGGAGGTCAGG + Intronic
1096587513 12:52632393-52632415 CTTCTATGCTGCCGTAAGTCTGG - Intergenic
1098100591 12:67011998-67012020 ACTCTAAGCTGCAGGAAGGCAGG + Intergenic
1101800791 12:108020257-108020279 TCCCTAAGGTGCCTGAAGCCAGG + Intergenic
1102061566 12:109936029-109936051 CCCCTGACCTTCCTGAAGTCTGG - Intronic
1104516636 12:129432958-129432980 ACCCTATGTTGCCAGAAGTCAGG - Intronic
1105928783 13:25032994-25033016 GCCCAAGGCTGCCGGAAGTGAGG + Intergenic
1115630127 14:35236453-35236475 CCCCTAAGCCCACTGAAGTCTGG + Intronic
1116697735 14:48199456-48199478 CCTCTAAGGTGGCGTAAGTCTGG - Intergenic
1125409320 15:39388888-39388910 TACCTGAGCTGCCTGAAGTCAGG - Intergenic
1127867133 15:63042338-63042360 GCCCTGAGCTGCCGGAGGCCGGG - Intergenic
1130037874 15:80378155-80378177 CCCCTGAGCTGGAGGCAGTCAGG + Exonic
1132890239 16:2200150-2200172 CCCCAAAGCTGCCCCAAGCCTGG + Intergenic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1134847400 16:17451451-17451473 AACCTGAGCTGCAGGAAGTCAGG + Intronic
1137063251 16:35811215-35811237 GGCCTGAGCTGCAGGAAGTCAGG - Intergenic
1138442038 16:57040966-57040988 CCCCTCAGCTGCTGGGGGTCAGG - Intronic
1145788839 17:27611596-27611618 TCCCCAAGCTGACAGAAGTCAGG - Exonic
1147319654 17:39638070-39638092 CCCCAACCCAGCCGGAAGTCTGG + Intronic
1154136109 18:11779706-11779728 CCCCTAGGCTGGGGGTAGTCTGG + Intronic
1157321092 18:46635136-46635158 CCCTTCAGCTGCCAGAAGACAGG - Intronic
1161001716 19:1914163-1914185 CCCCTGAGGGGCAGGAAGTCAGG + Intronic
1164770225 19:30802494-30802516 ACCATAAGCTGCTGGAAGGCAGG - Intergenic
1165339251 19:35198848-35198870 CCCCATAGGTGCAGGAAGTCAGG - Intergenic
1167880789 19:52455721-52455743 CACCTAAGCTCCCAGAAGTATGG - Intronic
1168702920 19:58452142-58452164 CCCCCTGGCTGCCGGAAGTCGGG - Intronic
925468184 2:4130063-4130085 CCTCTAAACTACCGGAAGACAGG - Intergenic
931369312 2:61647410-61647432 CCCCAAAGCTGCTGGATGTTGGG - Intergenic
933220358 2:79680545-79680567 ACCCTAAGCTGCTGGGAGTCAGG + Intronic
936274792 2:111085692-111085714 CCCCTAAGCTAGCAGAAGACAGG + Intronic
937118306 2:119425145-119425167 TTCCTAATCTGCCTGAAGTCTGG + Intergenic
943107644 2:183566510-183566532 ACCCTAAGCTGCTGAAAGTGAGG + Intergenic
947106223 2:226670410-226670432 CCCCTAAGCTGCCCAAATCCTGG + Intergenic
948595549 2:239077112-239077134 CACCTAAGCTGCCACAAGACGGG + Intronic
1169834055 20:9858101-9858123 ACTCTATGCTGCCAGAAGTCAGG - Intergenic
1174038013 20:47679976-47679998 ACTCTAAGCTGCAGGAAGGCTGG + Intronic
1174800456 20:53559077-53559099 AGCCTATGCTGCTGGAAGTCAGG - Intergenic
1175263804 20:57690736-57690758 ACCCCCACCTGCCGGAAGTCTGG + Intronic
1175497038 20:59422422-59422444 CCCCTAAGCTGCCCAAAGGCTGG - Intergenic
1183300266 22:37055536-37055558 CCCCTAGGCTCCCAGAAGGCAGG - Intronic
1184993007 22:48183239-48183261 CCTCTGAGCTTCTGGAAGTCAGG - Intergenic
950883027 3:16338326-16338348 CCCCTTAGCCGCCGCATGTCCGG - Intronic
950931861 3:16797840-16797862 CCCCTAGGTGGCTGGAAGTCAGG + Intergenic
953385335 3:42502834-42502856 CCCCCAGGCTGCCGGGACTCTGG - Intronic
955337911 3:58102291-58102313 CACCAAAGCTGCAGGAAGTGGGG + Exonic
959156992 3:102679040-102679062 TCCCTTATCTGCGGGAAGTCTGG + Intergenic
964880482 3:161417889-161417911 CCCCTTTGTTGCGGGAAGTCAGG - Intergenic
967926450 3:194652621-194652643 TCCCTACGATGCCGGAAGCCTGG + Intronic
981654576 4:147098955-147098977 CCCCTAAGATGTCAGAAGTGGGG - Intergenic
987045918 5:14108193-14108215 ACGCTAAGCTGCTTGAAGTCAGG + Intergenic
997633205 5:135385551-135385573 ACCCTAAGCTGCTTGAAGGCTGG + Intronic
1000015478 5:157272022-157272044 CCCCTGAGCTGCTGGTAGCCTGG + Intronic
1007913324 6:45537345-45537367 CCCCTAAGGTGCAGGGATTCGGG - Intronic
1019811708 7:3169752-3169774 CCCCCAGGCAGCTGGAAGTCAGG - Intronic
1020130618 7:5556689-5556711 CCCCTGAGCTGCCGGGAGCGGGG + Intronic
1022088959 7:27095651-27095673 CCCCCAGGTTCCCGGAAGTCTGG + Exonic
1027139735 7:75648631-75648653 CCCCTAAGCTGCCGGAAGTCAGG + Intronic
1029843173 7:103387319-103387341 CCCCTTATCTGCAGGAGGTCAGG - Intronic
1036514396 8:9430305-9430327 CTCCTATGTTGCGGGAAGTCAGG + Intergenic
1036631263 8:10517668-10517690 CCCCTGAGCTTCCAGAACTCTGG + Intergenic
1040928796 8:52713814-52713836 CCACTAGGCTGCCGGAGGTGTGG - Intronic
1048333245 8:133485395-133485417 CCACGAAGCTTCAGGAAGTCAGG - Intronic
1049311536 8:141936249-141936271 CCCCTCAGCAGCAGGAAGCCCGG + Intergenic
1049682625 8:143926442-143926464 ACCCTTTGCTGCCAGAAGTCGGG - Intronic
1051374626 9:16390500-16390522 ACCATAAGTTGCCTGAAGTCTGG - Intergenic
1054905634 9:70412282-70412304 CTCCTATGCTGCCTGAAGCCGGG + Intronic
1058985772 9:110207524-110207546 GACCTAAGCTGCCAGAAGTGGGG + Exonic
1061579759 9:131529824-131529846 CCCCTGAGATGCCGGAACACAGG + Intronic
1062443235 9:136582862-136582884 CCCTTAAGGTGCCTGGAGTCAGG + Intergenic
1187612311 X:20955693-20955715 CCCTTAAACTCCCGGAATTCTGG + Intergenic
1192184974 X:68940678-68940700 CCCCCAAGCAGCCTGAACTCTGG + Intergenic
1193569212 X:83121502-83121524 CTGCTAAGCTGCCTGAAGTGTGG - Intergenic
1200062263 X:153488868-153488890 CCCCTCAGCTGCAGGAGGGCAGG + Intronic