ID: 1027140034

View in Genome Browser
Species Human (GRCh38)
Location 7:75650323-75650345
Sequence GCTCCAAATTACCACTTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1058
Summary {0: 1, 1: 0, 2: 0, 3: 674, 4: 383}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027140034_1027140044 21 Left 1027140034 7:75650323-75650345 CCCTGTAAGTGGTAATTTGGAGC 0: 1
1: 0
2: 0
3: 674
4: 383
Right 1027140044 7:75650367-75650389 GAGCTGCCAGCCTTGTACTGGGG No data
1027140034_1027140042 19 Left 1027140034 7:75650323-75650345 CCCTGTAAGTGGTAATTTGGAGC 0: 1
1: 0
2: 0
3: 674
4: 383
Right 1027140042 7:75650365-75650387 AGGAGCTGCCAGCCTTGTACTGG No data
1027140034_1027140043 20 Left 1027140034 7:75650323-75650345 CCCTGTAAGTGGTAATTTGGAGC 0: 1
1: 0
2: 0
3: 674
4: 383
Right 1027140043 7:75650366-75650388 GGAGCTGCCAGCCTTGTACTGGG 0: 1
1: 0
2: 1
3: 15
4: 163
1027140034_1027140045 26 Left 1027140034 7:75650323-75650345 CCCTGTAAGTGGTAATTTGGAGC 0: 1
1: 0
2: 0
3: 674
4: 383
Right 1027140045 7:75650372-75650394 GCCAGCCTTGTACTGGGGAGAGG 0: 1
1: 0
2: 2
3: 16
4: 215
1027140034_1027140037 -1 Left 1027140034 7:75650323-75650345 CCCTGTAAGTGGTAATTTGGAGC 0: 1
1: 0
2: 0
3: 674
4: 383
Right 1027140037 7:75650345-75650367 CACCCTTAATGGCCCAGTTCAGG 0: 1
1: 0
2: 2
3: 7
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027140034 Original CRISPR GCTCCAAATTACCACTTACA GGG (reversed) Intronic
901009387 1:6190887-6190909 GTGCCAAAGTAGCACTTACAAGG + Intronic
901344298 1:8525602-8525624 GCTTCACAATACCACCTACATGG + Intronic
903313029 1:22475344-22475366 GCTCCATACTTCCTCTTACATGG + Intronic
908914690 1:69112619-69112641 CCTCCAAATTACAACATGCATGG + Intergenic
910795454 1:91092966-91092988 TCTCCAAATCACCACTATCATGG - Intergenic
912482780 1:109996839-109996861 GCTGCCAATTCCCCCTTACAAGG - Intronic
913172637 1:116246441-116246463 GGAACAAATTACCACATACAGGG - Intergenic
914921008 1:151847491-151847513 GCTGCAAATTACCCATTACCTGG + Intronic
914972949 1:152327858-152327880 GTTCCAAATTACACTTTACAAGG + Intergenic
917808028 1:178631423-178631445 GCTCTAATTTACAACTTGCATGG + Intergenic
919160574 1:193825144-193825166 GCTCCACATTACTAATTATAAGG + Intergenic
919263741 1:195235129-195235151 TTTACATATTACCACTTACAAGG + Intergenic
920925072 1:210333558-210333580 ACTACAAAATACCATTTACATGG - Intronic
922332180 1:224587026-224587048 GCAACAAATTACCACTAACTGGG - Intronic
923200003 1:231702541-231702563 GCATCAAATTTCCACATACATGG + Intronic
924789722 1:247234440-247234462 GCTCAACATTACCAGTCACAAGG + Intergenic
1072061546 10:91816434-91816456 GGTGCAAATTACTCCTTACAAGG - Intronic
1073361196 10:102900393-102900415 GCTTCTAATTACAACTTTCAAGG - Intronic
1074489276 10:113924464-113924486 GCTCCAAACTTCTAATTACATGG - Intergenic
1075271473 10:121055529-121055551 CCTCCAACTTACCTCTTTCAAGG - Intergenic
1078357786 11:10645539-10645561 GCTCTAAATTCGCACTTTCATGG + Intronic
1091314884 11:134607502-134607524 GCTCCAAAATGTCACTTGCATGG + Intergenic
1091573739 12:1713725-1713747 TCTCCCAATTACCACTGAGAAGG + Intronic
1094466875 12:30762815-30762837 GCTACAAATTACCACAAACTGGG - Intergenic
1095058252 12:37645680-37645702 GCTCCAAAAATCCACTTGCAGGG - Intergenic
1098848391 12:75565921-75565943 GCTTCAAATGAGCACTTACTTGG + Intergenic
1104378616 12:128287395-128287417 CCTCCAAATTAACATTTACCAGG + Intronic
1105405713 13:20131096-20131118 GCTACAAATTTTCACTTTCAGGG - Intergenic
1114835774 14:26201601-26201623 ACTAGAAATTACCACTTAAATGG - Intergenic
1115844705 14:37515388-37515410 GTTCCAAAATATCATTTACATGG - Intronic
1117751833 14:58931281-58931303 GATTCAAATTATCTCTTACAGGG + Intergenic
1124933545 15:34147826-34147848 GCTTCAAATTCCCACTCAAAAGG + Intronic
1126881980 15:53109158-53109180 GCTCCAAGTGACCATTTTCAAGG + Intergenic
1127789332 15:62384793-62384815 CCTCCAACTTACCTTTTACATGG + Intergenic
1127817301 15:62622366-62622388 CCTCCAAATTTGCAATTACATGG - Intronic
1130427270 15:83813828-83813850 GCTCCAAAATACCCCTGATAAGG - Intronic
1132311298 15:100859893-100859915 GCTCCAAGATGCCACTCACATGG - Intergenic
1132318286 15:100906330-100906352 GCCCCAAAATACCACCTCCAGGG - Intronic
1139860549 16:70017077-70017099 GCTCCAGACTCCCACTTAGAAGG + Intergenic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1147197790 17:38779287-38779309 GCTCCAGCTTCCCAATTACATGG + Intronic
1156057394 18:33024425-33024447 CCTCCAAATTTCCTCTTATAAGG + Intronic
1157974432 18:52310693-52310715 GCAACAAATTACCACTAACTGGG + Intergenic
1159640448 18:70858003-70858025 ACTAAAAATTATCACTTACAGGG - Intergenic
1164969347 19:32517862-32517884 CCTCTAACTGACCACTTACAAGG - Intergenic
1166264310 19:41668504-41668526 GCTCCTAATTGCCACTGACAGGG - Intronic
1166413072 19:42569810-42569832 ACTCCTAATTGCCACTGACAGGG - Intergenic
926207231 2:10842447-10842469 TCTCTTGATTACCACTTACAAGG + Intergenic
928926106 2:36580851-36580873 GCCCCAAATTTCCTCTTACAAGG - Intronic
929687317 2:44045869-44045891 AGTCCAAATTTCCTCTTACAAGG - Intergenic
936819860 2:116507493-116507515 ACTCAAAACTACCAATTACATGG - Intergenic
943573786 2:189606680-189606702 GCTACAAGTTACCAATTACTTGG - Intergenic
944892775 2:204134798-204134820 GCTGCAAATGATCACTTAAAAGG + Intergenic
945897831 2:215504516-215504538 TATCCAAATTACCTCTCACATGG + Intergenic
1168801822 20:648411-648433 GCTCCAAATTCCCAAGGACAAGG - Exonic
1169054948 20:2612984-2613006 GCTCCACATTACCAATTGTATGG - Intronic
1169568341 20:6880281-6880303 GTTCCAAATTAACATTTGCAAGG - Intergenic
1171578435 20:26366655-26366677 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171579468 20:26384213-26384235 GCTCCAAACGTCCACTTTCAGGG - Intergenic
1171579514 20:26384893-26384915 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171579697 20:26437517-26437539 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171579892 20:26440237-26440259 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171579993 20:26441597-26441619 GCTCCACATGTCCACTTCCAGGG - Intergenic
1171580110 20:26443094-26443116 ACTCCAAATGTCCACTTCCAGGG - Intergenic
1171580202 20:26444453-26444475 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171580303 20:26445813-26445835 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171580403 20:26447172-26447194 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171580704 20:26451252-26451274 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171580898 20:26453974-26453996 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171581001 20:26455333-26455355 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171581100 20:26456695-26456717 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171581202 20:26458055-26458077 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171581304 20:26459415-26459437 GCTCCCAATGTCCACTTCCACGG - Intergenic
1171581403 20:26460776-26460798 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171581506 20:26462136-26462158 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171581602 20:26463495-26463517 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171581703 20:26464854-26464876 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171581801 20:26466213-26466235 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171581903 20:26467573-26467595 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171582004 20:26468933-26468955 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171582105 20:26470291-26470313 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171582209 20:26471651-26471673 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171582312 20:26473010-26473032 GCACCAAATGTCCACTTCCAGGG - Intergenic
1171582414 20:26474369-26474391 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171582515 20:26475729-26475751 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171582616 20:26477089-26477111 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171582751 20:26479126-26479148 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171582853 20:26480486-26480508 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171582944 20:26481850-26481872 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171583039 20:26483210-26483232 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171583136 20:26484570-26484592 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171583206 20:26485588-26485610 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171583302 20:26486948-26486970 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171583404 20:26488307-26488329 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171583504 20:26489667-26489689 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171583606 20:26491027-26491049 GCACCAAATGTCCACTTCCAGGG - Intergenic
1171583707 20:26492388-26492410 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171583809 20:26493747-26493769 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171583910 20:26495107-26495129 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171584004 20:26496468-26496490 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171584101 20:26497828-26497850 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171584201 20:26499188-26499210 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171584303 20:26500548-26500570 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171584404 20:26501907-26501929 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171584504 20:26503267-26503289 GCACCAAATGTCCACTTCCAGGG - Intergenic
1171584606 20:26504627-26504649 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171584709 20:26505986-26506008 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171584811 20:26507345-26507367 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171584915 20:26508704-26508726 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171585016 20:26510064-26510086 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171585107 20:26511424-26511446 GCTCCAAATGTCCACTTCCACGG - Intergenic
1171585174 20:26512442-26512464 GCTCCAAATGTCCACCTCCAGGG - Intergenic
1171585271 20:26513802-26513824 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171585461 20:26516856-26516878 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171585558 20:26518217-26518239 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171585656 20:26519576-26519598 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171585753 20:26520935-26520957 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171585822 20:26521953-26521975 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171586074 20:26525693-26525715 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171586168 20:26527053-26527075 GCTCCACATGTCCACTTCCAGGG - Intergenic
1171586733 20:26535548-26535570 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171586830 20:26536908-26536930 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171586926 20:26538268-26538290 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171587085 20:26540645-26540667 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171587158 20:26541663-26541685 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171587419 20:26545403-26545425 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171587515 20:26546763-26546785 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171587678 20:26549143-26549165 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171587960 20:26553223-26553245 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171588056 20:26554583-26554605 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171588155 20:26555944-26555966 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171588232 20:26556962-26556984 GCTCCAAACGTCCACTTCCAGGG - Intergenic
1171588256 20:26557304-26557326 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171588358 20:26558664-26558686 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171588452 20:26560025-26560047 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171588643 20:26562745-26562767 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171588807 20:26565121-26565143 ACTCCAAATGTCCACTTCCAGGG - Intergenic
1171589089 20:26569200-26569222 TCTCCAAATGTCCACTTCCAGGG - Intergenic
1171589653 20:26577361-26577383 GCTCCAAACGTCCACTTTCAGGG - Intergenic
1171589752 20:26578722-26578744 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171589850 20:26580082-26580104 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171589924 20:26581098-26581120 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171589968 20:26581783-26581805 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171590064 20:26583143-26583165 GCTCCACATGTCCACTTCCAGGG - Intergenic
1171590164 20:26584502-26584524 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171590257 20:26585863-26585885 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171590413 20:26588138-26588160 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171590506 20:26589497-26589519 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171590637 20:26596833-26596855 ACTCCAAATGTCCACTTCCAGGG - Intergenic
1171590723 20:26598191-26598213 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171590823 20:26599552-26599574 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171590949 20:26601367-26601389 GCTCCACATGTCCACTTCCAGGG + Intergenic
1171591046 20:26602727-26602749 GCTCCAAATGTCCACTTCCAGGG + Intergenic
1171591147 20:26604087-26604109 GCTCCAAATGTCCACTTCCAGGG + Intergenic
1171591249 20:26605446-26605468 GCTCCAAATGTCCACTTCCAGGG + Intergenic
1171591351 20:26606805-26606827 GCTCCAAATGTCCACTTCCAGGG + Intergenic
1171591464 20:26608412-26608434 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171591826 20:26613851-26613873 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171592000 20:26616568-26616590 GCACCAAATGTCCACTTCCAGGG - Intergenic
1171592180 20:26619288-26619310 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171592362 20:26622007-26622029 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171592548 20:26624724-26624746 GCTCCAAAGGTCCACTTCCAGGG - Intergenic
1171592733 20:26627442-26627464 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171593026 20:26631862-26631884 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171593210 20:26634991-26635013 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171593385 20:26637710-26637732 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171593565 20:26640430-26640452 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171593877 20:26645193-26645215 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171594111 20:26648549-26648571 GCTCTAAATGTCCACTTCCAGGG - Intergenic
1171594294 20:26651270-26651292 GCTCCAAAGGTCCACTTCCAGGG - Intergenic
1171594476 20:26653989-26654011 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171594656 20:26656709-26656731 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171594837 20:26659429-26659451 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171595019 20:26662148-26662170 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171595201 20:26664869-26664891 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171595498 20:26669290-26669312 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171595680 20:26672009-26672031 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171595863 20:26674728-26674750 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171596045 20:26677448-26677470 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171596227 20:26680171-26680193 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171596397 20:26682718-26682740 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171596666 20:26686795-26686817 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171596761 20:26688155-26688177 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171596943 20:26690875-26690897 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171597125 20:26693594-26693616 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171597303 20:26696314-26696336 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171597465 20:26698695-26698717 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171597643 20:26701412-26701434 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171597822 20:26704131-26704153 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171598003 20:26706852-26706874 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171598186 20:26709570-26709592 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171598345 20:26711947-26711969 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171598514 20:26714497-26714519 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171598696 20:26717217-26717239 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171598879 20:26719937-26719959 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171599059 20:26722656-26722678 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171599240 20:26725373-26725395 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171599418 20:26728095-26728117 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171599598 20:26730816-26730838 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171599768 20:26733362-26733384 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171599949 20:26736076-26736098 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171600152 20:26739138-26739160 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171600335 20:26741858-26741880 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171600513 20:26744579-26744601 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171600698 20:26747293-26747315 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171600902 20:26750354-26750376 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171601088 20:26753074-26753096 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171601270 20:26755794-26755816 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171601499 20:26759189-26759211 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171601683 20:26761908-26761930 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171601868 20:26764627-26764649 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171602050 20:26767344-26767366 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171602231 20:26770064-26770086 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171602414 20:26772784-26772806 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171602592 20:26775503-26775525 GCTCCAAATGTACACTTCCAGGG - Intergenic
1171602791 20:26778564-26778586 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171602971 20:26781283-26781305 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171603240 20:26785361-26785383 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171603420 20:26788078-26788100 GCTCCAAATGTCCACGTCCAGGG - Intergenic
1171603603 20:26790798-26790820 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171603784 20:26793517-26793539 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171604057 20:26797597-26797619 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171604240 20:26800316-26800338 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171604512 20:26804394-26804416 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171604694 20:26807113-26807135 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171604873 20:26809831-26809853 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171605055 20:26812550-26812572 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171605254 20:26815611-26815633 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171605436 20:26818333-26818355 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171605707 20:26822411-26822433 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171605887 20:26825132-26825154 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171606032 20:26827173-26827195 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171606323 20:26831592-26831614 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171606617 20:26836012-26836034 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171606796 20:26838733-26838755 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171607067 20:26842813-26842835 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171607267 20:26845873-26845895 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171607449 20:26848591-26848613 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171607631 20:26851310-26851332 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171607831 20:26854372-26854394 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171608014 20:26857092-26857114 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171608197 20:26859812-26859834 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171608400 20:26862873-26862895 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171608583 20:26865592-26865614 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171608872 20:26870011-26870033 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171609032 20:26872388-26872410 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171609217 20:26875108-26875130 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171609397 20:26877827-26877849 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171609689 20:26882248-26882270 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171609873 20:26884966-26884988 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171610056 20:26887686-26887708 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171610262 20:26890745-26890767 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171610445 20:26893465-26893487 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171610625 20:26896183-26896205 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171610782 20:26898562-26898584 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171610853 20:26899580-26899602 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171611036 20:26902299-26902321 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171611219 20:26905019-26905041 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171611399 20:26907741-26907763 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171611581 20:26910461-26910483 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171611762 20:26913180-26913202 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171611944 20:26915897-26915919 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171612121 20:26918616-26918638 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171612302 20:26921335-26921357 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171612594 20:26925756-26925778 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171612776 20:26928478-26928500 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171612954 20:26931198-26931220 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171613137 20:26933918-26933940 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171613321 20:26936637-26936659 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171613504 20:26939357-26939379 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171613685 20:26942076-26942098 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171613868 20:26944795-26944817 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171614049 20:26947515-26947537 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171614230 20:26950236-26950258 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171614413 20:26952955-26952977 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171614608 20:26956016-26956038 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171614903 20:26960434-26960456 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171615085 20:26963154-26963176 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171615210 20:26965021-26965043 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171615332 20:26966720-26966742 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171615531 20:26969781-26969803 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171615713 20:26972501-26972523 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171615897 20:26975221-26975243 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171616080 20:26977938-26977960 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171616240 20:26980315-26980337 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171616408 20:26982866-26982888 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171616593 20:26985584-26985606 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171616776 20:26988303-26988325 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171616953 20:26991026-26991048 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171617136 20:26993747-26993769 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171617319 20:26996466-26996488 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171617526 20:26999527-26999549 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171617728 20:27002589-27002611 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171617896 20:27005137-27005159 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171618054 20:27007515-27007537 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171618346 20:27011937-27011959 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171618633 20:27016358-27016380 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171618819 20:27019077-27019099 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171619022 20:27022140-27022162 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171619296 20:27026218-27026240 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171619480 20:27028936-27028958 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171619772 20:27033355-27033377 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171619843 20:27034374-27034396 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171620240 20:27040500-27040522 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171620536 20:27044921-27044943 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171620716 20:27047640-27047662 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171620885 20:27050188-27050210 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171621028 20:27052224-27052246 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171621208 20:27054944-27054966 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171621391 20:27057663-27057685 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171621576 20:27060382-27060404 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171621761 20:27063099-27063121 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171622084 20:27068202-27068224 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171622265 20:27070922-27070944 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171622446 20:27073642-27073664 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171622632 20:27076366-27076388 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171622791 20:27078745-27078767 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171622974 20:27081464-27081486 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171623272 20:27085881-27085903 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171623443 20:27088429-27088451 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171623645 20:27091491-27091513 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171623934 20:27095913-27095935 GCTCCAAAGGTCCACTTCCAGGG - Intergenic
1171624270 20:27101018-27101040 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171624453 20:27103737-27103759 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171624635 20:27106456-27106478 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171624813 20:27109175-27109197 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171624998 20:27111894-27111916 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171625289 20:27116312-27116334 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171625466 20:27119030-27119052 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171625640 20:27121578-27121600 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171625823 20:27124299-27124321 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171626009 20:27127018-27127040 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171626413 20:27133138-27133160 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171626573 20:27135515-27135537 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171626710 20:27137555-27137577 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171626890 20:27140274-27140296 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171627185 20:27144695-27144717 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171627363 20:27147414-27147436 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171627546 20:27150134-27150156 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171627706 20:27152511-27152533 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171627886 20:27155230-27155252 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171628068 20:27157949-27157971 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171628253 20:27160668-27160690 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171628369 20:27162365-27162387 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171628555 20:27165084-27165106 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171628824 20:27169160-27169182 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171629009 20:27171881-27171903 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171629299 20:27176302-27176324 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171629481 20:27179021-27179043 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171629665 20:27181740-27181762 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171629847 20:27184459-27184481 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171630015 20:27187009-27187031 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171630305 20:27191430-27191452 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171630488 20:27194150-27194172 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171630671 20:27196868-27196890 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171630853 20:27199588-27199610 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171631037 20:27202308-27202330 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171631218 20:27205027-27205049 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171631401 20:27207746-27207768 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171631580 20:27210465-27210487 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171631872 20:27214883-27214905 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171632271 20:27221005-27221027 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171632448 20:27223725-27223747 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171632632 20:27226444-27226466 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171632814 20:27229164-27229186 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171632999 20:27231886-27231908 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171633181 20:27234607-27234629 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171633364 20:27237326-27237348 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171633550 20:27240045-27240067 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171633731 20:27242764-27242786 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171633923 20:27245653-27245675 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171634106 20:27248374-27248396 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171634289 20:27251093-27251115 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171634473 20:27253820-27253842 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171634701 20:27257219-27257241 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171634887 20:27259938-27259960 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171635071 20:27262655-27262677 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171635253 20:27265374-27265396 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171635417 20:27267752-27267774 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171635597 20:27270471-27270493 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171635758 20:27272850-27272872 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171635938 20:27275569-27275591 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171636120 20:27278289-27278311 ACTCCAAATGTCCACTTCCAGGG - Intergenic
1171636360 20:27281857-27281879 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171636542 20:27284577-27284599 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171636724 20:27287301-27287323 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171636927 20:27290363-27290385 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171637107 20:27293083-27293105 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171637311 20:27296270-27296292 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171637489 20:27298987-27299009 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171637558 20:27300005-27300027 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171637739 20:27302725-27302747 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171637920 20:27305444-27305466 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171638101 20:27308163-27308185 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171638284 20:27310883-27310905 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171638488 20:27313944-27313966 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171638669 20:27316663-27316685 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171639069 20:27322785-27322807 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171639253 20:27325504-27325526 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171639436 20:27328225-27328247 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171639712 20:27332299-27332321 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171639788 20:27333318-27333340 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171639973 20:27336039-27336061 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171640148 20:27338589-27338611 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171640324 20:27341308-27341330 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171640506 20:27344027-27344049 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171640685 20:27346746-27346768 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171640980 20:27351169-27351191 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171641260 20:27355416-27355438 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171641465 20:27358479-27358501 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171641757 20:27362898-27362920 CCTCCAAATGTCCACTTCCAGGG - Intergenic
1171641941 20:27365617-27365639 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171642123 20:27368336-27368358 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171642308 20:27371056-27371078 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171642492 20:27373773-27373795 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171642855 20:27379212-27379234 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171643037 20:27381930-27381952 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171643219 20:27384647-27384669 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171643399 20:27387366-27387388 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171643583 20:27390086-27390108 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171643766 20:27392806-27392828 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171643947 20:27395526-27395548 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171644131 20:27398247-27398269 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171644443 20:27403011-27403033 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171644650 20:27406072-27406094 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171644852 20:27409134-27409156 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171644926 20:27410152-27410174 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171645105 20:27412871-27412893 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171645304 20:27415932-27415954 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171645485 20:27418650-27418672 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171645670 20:27421371-27421393 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171645851 20:27424089-27424111 CCTCCAAATGTCCACTTCCAGGG - Intergenic
1171645924 20:27425107-27425129 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171646106 20:27427824-27427846 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171646194 20:27429181-27429203 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171646266 20:27430199-27430221 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171646449 20:27432919-27432941 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171646636 20:27435635-27435657 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171646808 20:27438182-27438204 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171646990 20:27440902-27440924 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171647161 20:27443450-27443472 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171647341 20:27446170-27446192 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171647541 20:27449230-27449252 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171647725 20:27451949-27451971 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171647820 20:27453310-27453332 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171648008 20:27456031-27456053 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171648300 20:27460451-27460473 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171648482 20:27463170-27463192 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171648665 20:27465889-27465911 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171648959 20:27470307-27470329 GCTCCAAAGGTCCACTTCCAGGG - Intergenic
1171649161 20:27473367-27473389 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171649343 20:27476087-27476109 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171649548 20:27479147-27479169 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171649729 20:27481866-27481888 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171649912 20:27484585-27484607 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171650096 20:27487303-27487325 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171650278 20:27490022-27490044 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171650459 20:27492741-27492763 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171650638 20:27495459-27495481 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171650820 20:27498178-27498200 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171651004 20:27500896-27500918 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171651186 20:27503615-27503637 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171651266 20:27504889-27504911 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171651463 20:27507951-27507973 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171651642 20:27510670-27510692 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171651803 20:27513047-27513069 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171651986 20:27515766-27515788 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171652170 20:27518485-27518507 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171652694 20:27526725-27526747 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171652873 20:27529443-27529465 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171653053 20:27532162-27532184 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171653253 20:27535224-27535246 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171653432 20:27537944-27537966 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171653714 20:27542193-27542215 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171653997 20:27546442-27546464 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171654178 20:27549163-27549185 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171654361 20:27551883-27551905 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171654544 20:27554600-27554622 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171654724 20:27557322-27557344 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171654906 20:27560041-27560063 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171655095 20:27562758-27562780 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171655389 20:27567180-27567202 TCTCCAAATGTCCACTTCCAGGG - Intergenic
1171655570 20:27569900-27569922 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171655685 20:27571598-27571620 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171655868 20:27574317-27574339 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171656047 20:27577037-27577059 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171656214 20:27579583-27579605 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171656383 20:27582131-27582153 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171656584 20:27585188-27585210 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171656785 20:27588250-27588272 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171656855 20:27589268-27589290 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171657036 20:27591986-27592008 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171657218 20:27594706-27594728 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171657400 20:27597427-27597449 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171657582 20:27600146-27600168 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171657809 20:27603545-27603567 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171657979 20:27606091-27606113 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171658289 20:27610853-27610875 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171658490 20:27613917-27613939 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171658669 20:27616636-27616658 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171658955 20:27621055-27621077 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171659117 20:27623432-27623454 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171659300 20:27626150-27626172 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171659463 20:27628526-27628548 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171659646 20:27631247-27631269 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171659818 20:27633795-27633817 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171660011 20:27636681-27636703 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171660196 20:27639400-27639422 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171660378 20:27642120-27642142 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171660581 20:27645181-27645203 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171660759 20:27647903-27647925 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171660831 20:27648921-27648943 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171661013 20:27651641-27651663 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171661194 20:27654362-27654384 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171661333 20:27656403-27656425 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171661518 20:27659122-27659144 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171661678 20:27661500-27661522 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171661862 20:27664219-27664241 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171661933 20:27665236-27665258 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171662315 20:27671015-27671037 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171662500 20:27673733-27673755 GCTCCAAAGGTCCACTTCCAGGG - Intergenic
1171662683 20:27676452-27676474 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171662864 20:27679173-27679195 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171663156 20:27683594-27683616 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171663339 20:27686314-27686336 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171663489 20:27688522-27688544 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171663661 20:27691071-27691093 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171663844 20:27693791-27693813 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171664014 20:27696339-27696361 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171664196 20:27699057-27699079 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171664374 20:27701777-27701799 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171664660 20:27706199-27706221 TCTCCAAATGTCCACTTCCAGGG - Intergenic
1171665023 20:27711639-27711661 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171665204 20:27714357-27714379 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171665371 20:27716905-27716927 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171665551 20:27719624-27719646 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171665839 20:27724043-27724065 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171665999 20:27726420-27726442 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171666193 20:27729310-27729332 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171666379 20:27732030-27732052 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171666560 20:27734750-27734772 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171666743 20:27737470-27737492 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171666812 20:27738488-27738510 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171666994 20:27741207-27741229 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171667172 20:27743926-27743948 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171667351 20:27746644-27746666 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171667532 20:27749364-27749386 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171667715 20:27752083-27752105 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171667984 20:27756160-27756182 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171668154 20:27758709-27758731 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171668338 20:27761426-27761448 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171668433 20:27762786-27762808 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171668604 20:27765336-27765358 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171668785 20:27768054-27768076 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171668950 20:27770600-27770622 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171669240 20:27775019-27775041 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171669420 20:27777739-27777761 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171669603 20:27780460-27780482 GCTCCAAATGTACACTTCCAGGG - Intergenic
1171669897 20:27784883-27784905 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171670097 20:27787944-27787966 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171670283 20:27790664-27790686 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171670462 20:27793383-27793405 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171670646 20:27796102-27796124 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171670717 20:27797120-27797142 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171670891 20:27799668-27799690 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171671094 20:27802725-27802747 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171671276 20:27805444-27805466 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171671446 20:27807991-27808013 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171671514 20:27809009-27809031 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171671700 20:27811728-27811750 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171671880 20:27814445-27814467 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171672062 20:27817166-27817188 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171672329 20:27821250-27821272 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171672498 20:27823798-27823820 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171672682 20:27826518-27826540 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171672851 20:27829066-27829088 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171673034 20:27831785-27831807 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171673330 20:27836206-27836228 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171673512 20:27838925-27838947 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171673695 20:27841647-27841669 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171673988 20:27846067-27846089 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171674170 20:27848785-27848807 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171674453 20:27853036-27853058 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171674633 20:27855756-27855778 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171674814 20:27858476-27858498 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171675330 20:27866299-27866321 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171675514 20:27869021-27869043 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171675696 20:27871808-27871830 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171675768 20:27872826-27872848 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171675951 20:27875546-27875568 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171676124 20:27878094-27878116 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171676307 20:27880813-27880835 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171676463 20:27883190-27883212 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171676666 20:27886251-27886273 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171676834 20:27888797-27888819 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171677013 20:27891515-27891537 GCTCAAAATGTCCACTTCCAGGG - Intergenic
1171677193 20:27894232-27894254 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171677475 20:27898480-27898502 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171677654 20:27901199-27901221 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171677837 20:27903918-27903940 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171678107 20:27907997-27908019 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171678278 20:27910546-27910568 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171678459 20:27913266-27913288 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171678624 20:27915645-27915667 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171678962 20:27920751-27920773 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171679144 20:27923470-27923492 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171679323 20:27926189-27926211 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171679618 20:27930610-27930632 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171679897 20:27934858-27934880 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171680079 20:27937577-27937599 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171680249 20:27940127-27940149 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171680518 20:27944205-27944227 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171680701 20:27946926-27946948 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171680772 20:27947944-27947966 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171680961 20:27950836-27950858 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171681033 20:27951854-27951876 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171681175 20:27953891-27953913 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171681469 20:27958312-27958334 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171681650 20:27961029-27961051 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171681864 20:27964255-27964277 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171681934 20:27965274-27965296 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171682118 20:27967993-27968015 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171682301 20:27970711-27970733 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171682483 20:27973432-27973454 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171682665 20:27976149-27976171 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171682735 20:27977167-27977189 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171682895 20:27979543-27979565 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171683095 20:27982602-27982624 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171683271 20:27985325-27985347 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171683451 20:27988046-27988068 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171683636 20:27990765-27990787 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171683821 20:27993488-27993510 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171683962 20:27995528-27995550 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171684143 20:27998247-27998269 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171684325 20:28000967-28000989 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171684724 20:28007086-28007108 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171684792 20:28008103-28008125 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171684970 20:28010822-28010844 GCTCCAAATGTACACTTCCAGGG - Intergenic
1171685140 20:28013370-28013392 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171685429 20:28017789-28017811 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171685611 20:28020507-28020529 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171685793 20:28023227-28023249 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171685863 20:28024245-28024267 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171686032 20:28026793-28026815 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171686216 20:28029512-28029534 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171686291 20:28030531-28030553 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171686586 20:28034951-28034973 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171686772 20:28037670-28037692 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171686953 20:28040389-28040411 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171687122 20:28042938-28042960 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171687444 20:28047864-28047886 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171687614 20:28050411-28050433 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171688014 20:28056533-28056555 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171688333 20:28061293-28061315 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171688506 20:28063841-28063863 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171688688 20:28066558-28066580 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171688782 20:28067918-28067940 GCTACAAATGTCCACTTCCAGGG - Intergenic
1171688966 20:28070636-28070658 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171689037 20:28071654-28071676 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171689214 20:28074374-28074396 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171689285 20:28075392-28075414 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171689569 20:28079643-28079665 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171689877 20:28084405-28084427 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171690060 20:28087124-28087146 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171690231 20:28089675-28089697 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171690302 20:28090693-28090715 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171690484 20:28093413-28093435 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171690656 20:28095961-28095983 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171690860 20:28099025-28099047 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171691049 20:28101919-28101941 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171691120 20:28102937-28102959 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171691405 20:28107186-28107208 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171691575 20:28109734-28109756 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171691758 20:28112454-28112476 GCACCAAATGTCCACTTCCAGGG - Intergenic
1171691938 20:28115174-28115196 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171692282 20:28120273-28120295 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171692452 20:28122822-28122844 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171692636 20:28125539-28125561 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171692806 20:28128088-28128110 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171692982 20:28130641-28130663 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171693164 20:28133360-28133382 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171693346 20:28136079-28136101 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171693418 20:28137098-28137120 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171693598 20:28139817-28139839 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171693893 20:28144239-28144261 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171693967 20:28145259-28145281 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171694139 20:28147806-28147828 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171694311 20:28150355-28150377 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171694497 20:28153075-28153097 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171694924 20:28159542-28159564 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171695108 20:28162260-28162282 GCTCCAAAGGTCCACTTCCAGGG - Intergenic
1171695290 20:28164978-28165000 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171695461 20:28167527-28167549 GCTCCAAAGGTCCACTTCCAGGG - Intergenic
1171695827 20:28173140-28173162 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171695998 20:28175690-28175712 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171696168 20:28178238-28178260 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171696372 20:28181070-28181092 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171696654 20:28185317-28185339 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171696829 20:28187865-28187887 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171697000 20:28190413-28190435 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171697172 20:28192965-28192987 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171697366 20:28195856-28195878 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171697522 20:28198234-28198256 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171697592 20:28199251-28199273 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171697762 20:28201800-28201822 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171697932 20:28204348-28204370 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171698100 20:28206897-28206919 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171698266 20:28209446-28209468 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171698456 20:28212338-28212360 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171698630 20:28214886-28214908 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171698797 20:28217434-28217456 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171698978 20:28220155-28220177 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171699259 20:28224405-28224427 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171699553 20:28228995-28229017 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171699721 20:28231543-28231565 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171699891 20:28234091-28234113 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171700128 20:28237660-28237682 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171700295 20:28240213-28240235 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171700727 20:28246848-28246870 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171701117 20:28252797-28252819 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171701198 20:28253985-28254007 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171701372 20:28256790-28256812 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171701540 20:28259339-28259361 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171701952 20:28265632-28265654 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171702343 20:28271582-28271604 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171702636 20:28276003-28276025 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171703028 20:28281955-28281977 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171703330 20:28286547-28286569 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171703498 20:28289096-28289118 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171703581 20:28290284-28290306 GCTCCAATTGGCCACTTCCAGGG - Intergenic
1171703747 20:28292831-28292853 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171703918 20:28295378-28295400 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171704088 20:28297927-28297949 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171704379 20:28302344-28302366 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171704879 20:28309999-28310021 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171705179 20:28314590-28314612 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171705345 20:28317137-28317159 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171705483 20:28319132-28319154 GCTCCAAATGTGCACTTCCAGGG - Intergenic
1171705654 20:28321680-28321702 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171705828 20:28324228-28324250 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171706104 20:28328479-28328501 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171706275 20:28331028-28331050 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171706445 20:28333575-28333597 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171706699 20:28337480-28337502 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171706867 20:28340028-28340050 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171707038 20:28342575-28342597 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171707209 20:28345123-28345145 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171707380 20:28347674-28347696 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171707773 20:28353623-28353645 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171708059 20:28357873-28357895 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171708335 20:28362121-28362143 GCTCCAAATGTACACTTCCAGGG - Intergenic
1171708508 20:28364672-28364694 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171708677 20:28367217-28367239 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171708960 20:28371467-28371489 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171709128 20:28374015-28374037 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171709297 20:28376563-28376585 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171709465 20:28379112-28379134 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171709634 20:28381661-28381683 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171709809 20:28384209-28384231 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171709956 20:28386415-28386437 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171710126 20:28388965-28388987 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171710295 20:28391513-28391535 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171710462 20:28394062-28394084 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171710632 20:28396610-28396632 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171710811 20:28399330-28399352 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171711091 20:28403580-28403602 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171711266 20:28406129-28406151 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171711335 20:28407147-28407169 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171711504 20:28409693-28409715 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171711673 20:28412241-28412263 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171711954 20:28416496-28416518 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171712139 20:28419389-28419411 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171712211 20:28420407-28420429 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171712380 20:28422957-28422979 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171712552 20:28425509-28425531 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171712726 20:28428058-28428080 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171712898 20:28430606-28430628 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171713066 20:28433155-28433177 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171713235 20:28435703-28435725 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171713404 20:28438250-28438272 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171713574 20:28440798-28440820 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171713743 20:28443344-28443366 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171713914 20:28445892-28445914 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171714104 20:28448763-28448785 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171714278 20:28451311-28451333 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171714449 20:28453857-28453879 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171714617 20:28456408-28456430 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171714787 20:28458957-28458979 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171714958 20:28461506-28461528 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171715133 20:28464053-28464075 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171715299 20:28466601-28466623 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171715467 20:28469149-28469171 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171715636 20:28471697-28471719 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171715804 20:28474246-28474268 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171715973 20:28476795-28476817 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171716142 20:28479343-28479365 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171716312 20:28481891-28481913 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171716482 20:28484439-28484461 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171716651 20:28486991-28487013 GCTCCAATTGTCCACTTCCAGGG - Intergenic
1171716822 20:28489540-28489562 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171716992 20:28492087-28492109 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171717594 20:28507121-28507143 TCTCCAAATGTCCACTTCCAGGG - Intergenic
1171717695 20:28508481-28508503 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1171740913 20:28886860-28886882 ACTCCAAATGTCCACTTGCAGGG + Intergenic
1171740946 20:28887538-28887560 ACTCCAAATGTCCACTTGCAGGG + Intergenic
1175590761 20:60190092-60190114 GCTGCAAACTGCCACTGACATGG - Intergenic
1176637283 21:9258360-9258382 GCTATAAATTAGCACTTCCATGG - Intergenic
1179110902 21:38444277-38444299 ACCCCAAATCACCACTTAAATGG - Intronic
952223722 3:31352104-31352126 GCTCCAAGTTGCCAATCACATGG - Intergenic
952377760 3:32781391-32781413 GCTCCAAACTACCCATTACGTGG + Intergenic
952434195 3:33255965-33255987 GTGCAAAATTACCTCTTACAAGG - Intergenic
956467034 3:69529456-69529478 GCTGCAAATTACCACTTGTCTGG + Intronic
958201474 3:90322284-90322306 GCTCAAAATATCCACTTGCAGGG + Intergenic
962111308 3:132452046-132452068 ATTCCAAATTACCACTGACCAGG - Intronic
963004629 3:140714965-140714987 GCCCCAAATTATCACTCTCATGG + Intergenic
963622231 3:147624790-147624812 GCTCCAAATTGCCAAGTTCAGGG - Intergenic
964154347 3:153565784-153565806 TCCCCGATTTACCACTTACAGGG + Intergenic
965471902 3:169103937-169103959 GCTACAAATTGCAACGTACAGGG + Intronic
966425130 3:179772799-179772821 GCTCCAAATTACCAGTCTCTCGG - Intronic
1202749611 3_GL000221v1_random:146659-146681 GCTATAAATTAGCACTTCCATGG + Intergenic
972685017 4:41344118-41344140 GCCCCAAATTTCAATTTACATGG + Intergenic
973406087 4:49738699-49738721 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973409031 4:49787008-49787030 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973409344 4:49792106-49792128 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973410356 4:49808935-49808957 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973411975 4:49835641-49835663 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973412444 4:49843296-49843318 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973412591 4:49845842-49845864 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973412747 4:49848392-49848414 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973412897 4:49850942-49850964 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973413095 4:49854173-49854195 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973415175 4:49888347-49888369 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973415523 4:49894124-49894146 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973415677 4:49896672-49896694 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973415829 4:49899218-49899240 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973417136 4:49920643-49920665 GCTCAAAATCTCCACTTCCAGGG - Intergenic
973418765 4:49947662-49947684 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973418834 4:49948847-49948869 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973418981 4:49951393-49951415 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973419134 4:49953940-49953962 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973420517 4:49976556-49976578 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973420671 4:49979103-49979125 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973420820 4:49981650-49981672 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973421916 4:49999508-49999530 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973422062 4:50002055-50002077 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973422551 4:50010218-50010240 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973422712 4:50012935-50012957 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973423460 4:50025178-50025200 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973423614 4:50027729-50027751 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973423965 4:50033510-50033532 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973424119 4:50036057-50036079 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973424274 4:50038605-50038627 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973425109 4:50052545-50052567 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973425382 4:50056973-50056995 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973426705 4:50078907-50078929 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973427869 4:50098298-50098320 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973428813 4:50113775-50113797 GCTCTAAATCTCCACTTCCAGGG - Intergenic
973428896 4:50115136-50115158 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973429973 4:50133153-50133175 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973431225 4:50153736-50153758 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973431565 4:50159512-50159534 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973432854 4:50180771-50180793 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973432935 4:50182130-50182152 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973433086 4:50184682-50184704 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973433230 4:50187233-50187255 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973433376 4:50189784-50189806 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973434077 4:50201347-50201369 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973435000 4:50216819-50216841 GCTCGAAATCGCCACTTCCAGGG - Intergenic
973435152 4:50219367-50219389 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973437061 4:50250328-50250350 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973437216 4:50252879-50252901 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973437362 4:50255424-50255446 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973438103 4:50267667-50267689 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973438254 4:50270214-50270236 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973438402 4:50272761-50272783 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973438746 4:50278533-50278555 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973439862 4:50296731-50296753 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973440825 4:50312719-50312741 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973442521 4:50340444-50340466 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973442589 4:50341631-50341653 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973442739 4:50344178-50344200 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973444661 4:50375803-50375825 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973444809 4:50378351-50378373 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973445296 4:50386516-50386538 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973445636 4:50392298-50392320 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973446043 4:50399262-50399284 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973447358 4:50421195-50421217 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973447851 4:50429352-50429374 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973448001 4:50431898-50431920 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973450341 4:50470500-50470522 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973450724 4:50476610-50476632 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973450877 4:50479158-50479180 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973450957 4:50480517-50480539 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973451113 4:50483067-50483089 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973451265 4:50485619-50485641 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973452079 4:50499221-50499243 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973454684 4:50542410-50542432 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973454834 4:50544961-50544983 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973454983 4:50547507-50547529 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973455134 4:50550054-50550076 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973455674 4:50559070-50559092 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973457780 4:50593250-50593272 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973458100 4:50598520-50598542 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973460310 4:50634589-50634611 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973462568 4:50671823-50671845 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973462642 4:50673014-50673036 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973463078 4:50680159-50680181 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973465689 4:50723013-50723035 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973467437 4:50751927-50751949 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973468513 4:50769745-50769767 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973469931 4:50793030-50793052 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973470816 4:50807828-50807850 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973471896 4:50825517-50825539 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973472756 4:50839804-50839826 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973472911 4:50842351-50842373 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973473341 4:50849321-50849343 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973473626 4:50853909-50853931 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973473950 4:50859172-50859194 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973474805 4:50873273-50873295 GCTCGAAATCGCCACTTCCAGGG - Intergenic
973475099 4:50878374-50878396 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973476412 4:50900146-50900168 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973476539 4:50902184-50902206 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973476879 4:50907962-50907984 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973477485 4:50918163-50918185 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973477682 4:50921556-50921578 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973478042 4:50927335-50927357 GCTCGAAATCGCCACTTCCAGGG - Intergenic
973478622 4:50936858-50936880 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973480075 4:50960834-50960856 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973480732 4:50971715-50971737 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973481977 4:50992292-50992314 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973482056 4:50993649-50993671 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973482461 4:51000453-51000475 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973482812 4:51006235-51006257 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973483164 4:51012014-51012036 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973483581 4:51018987-51019009 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973483810 4:51022727-51022749 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973484010 4:51026127-51026149 GCTCGAAATCGCCACTTCCAGGG - Intergenic
973484094 4:51027486-51027508 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973484242 4:51030034-51030056 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973484691 4:51037345-51037367 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973485235 4:51046362-51046384 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973485435 4:51049596-51049618 GCTCGAAATCTCCACTTTCAGGG - Intergenic
973488891 4:51106572-51106594 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973489243 4:51112703-51112725 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973489513 4:51117121-51117143 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973491169 4:51143991-51144013 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973491801 4:51154201-51154223 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973492394 4:51164060-51164082 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973493828 4:51187879-51187901 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973494027 4:51191113-51191135 GCTCGAAATCGCCACTTCCAGGG - Intergenic
973494222 4:51194340-51194362 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973495392 4:51213729-51213751 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973495462 4:51214916-51214938 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973496402 4:51230397-51230419 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973498296 4:51261361-51261383 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973498438 4:51263738-51263760 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973498737 4:51268842-51268864 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973498864 4:51270881-51270903 GCTCGAAATCGCCACTTCCAGGG - Intergenic
973499331 4:51278700-51278722 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973500025 4:51290264-51290286 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973500372 4:51296034-51296056 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973500693 4:51301307-51301329 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973501360 4:51312189-51312211 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973502408 4:51329541-51329563 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973504040 4:51356407-51356429 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973504627 4:51366096-51366118 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973505103 4:51373753-51373775 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973505528 4:51380726-51380748 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973506595 4:51398076-51398098 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973507485 4:51412876-51412898 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973508027 4:51422040-51422062 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973508788 4:51434294-51434316 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973509216 4:51441272-51441294 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973509407 4:51444511-51444533 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973509601 4:51447745-51447767 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973509671 4:51448935-51448957 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973510833 4:51468151-51468173 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973511235 4:51474618-51474640 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973511314 4:51475974-51475996 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973511696 4:51482439-51482461 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973511841 4:51484990-51485012 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973512234 4:51491453-51491475 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973512434 4:51494689-51494711 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973512794 4:51500470-51500492 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973512920 4:51502507-51502529 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973513120 4:51505739-51505761 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973513323 4:51508971-51508993 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973514043 4:51520707-51520729 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973514662 4:51530915-51530937 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973515204 4:51539935-51539957 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973515854 4:51550655-51550677 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973516391 4:51559500-51559522 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973517450 4:51577004-51577026 GCTCGAAATCTCCACTTTCAGGG - Intergenic
973517979 4:51585503-51585525 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973518302 4:51590784-51590806 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973518614 4:51595887-51595909 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973518809 4:51599117-51599139 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973518963 4:51601666-51601688 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973519513 4:51610684-51610706 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973519839 4:51615960-51615982 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973519967 4:51617998-51618020 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973521026 4:51635513-51635535 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973521218 4:51638748-51638770 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973521560 4:51644372-51644394 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973522184 4:51654573-51654595 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973522455 4:51658996-51659018 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973522580 4:51661036-51661058 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973523072 4:51669038-51669060 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973524214 4:51687748-51687770 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973524539 4:51693018-51693040 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973524984 4:51700323-51700345 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973525204 4:51703896-51703918 GCTCGAAATCGCCACTTCCAGGG - Intergenic
973525605 4:51710363-51710385 GCTCGAAATCGCCACTTCCAGGG - Intergenic
973525683 4:51711718-51711740 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973526006 4:51716997-51717019 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973526374 4:51722952-51722974 GCTCGAAATGTCCACTTCCATGG - Intergenic
973526480 4:51724653-51724675 GCTCGAAATCTCCACTTCCAGGG - Intergenic
973527198 4:51736391-51736413 GCTCGAAATCTCCACTTCCAGGG - Intergenic
978870879 4:113575909-113575931 GCTTCAAATTCCTACTTACTAGG - Intronic
980171487 4:129295141-129295163 GATCCAAATACTCACTTACATGG - Intergenic
983406633 4:167339249-167339271 GCAACAAATTACCACAAACATGG + Intergenic
983638889 4:169925825-169925847 GGTCCAAATTTCCATTTCCAAGG - Intergenic
984913828 4:184701761-184701783 GTCCAAAATGACCACTTACATGG - Intronic
985682664 5:1264681-1264703 GCTCCAAATCACCACTTCTCTGG - Intronic
993656310 5:90581974-90581996 GCTCCAAATTACACAATACATGG - Intronic
997205450 5:132046056-132046078 CCTCCTAATTCCCTCTTACAAGG + Intergenic
1003458925 6:6311215-6311237 GCTCCAAATTTTCACGTAAAAGG - Intronic
1005343152 6:24862469-24862491 GCTCCAAATGATCACTCTCATGG + Intronic
1011032094 6:82934468-82934490 GCTGCAAGTTACGACTTACATGG + Intronic
1014107702 6:117585566-117585588 GCCCCAAATTACAAATTGCATGG + Intronic
1015280018 6:131423030-131423052 GTTGCAAATTACCACAAACATGG - Intergenic
1018693619 6:166371122-166371144 TCTCCAACTTACCACTTTTAAGG - Intronic
1019635843 7:2075154-2075176 GCTCCTAATTGCCACTTCCTCGG - Intronic
1020363805 7:7358064-7358086 TCTCCCTATTACCACTTTCAGGG + Exonic
1023372065 7:39521736-39521758 GCTGCAAATTAGCTCATACACGG + Intergenic
1024492556 7:50002185-50002207 GAGCCAAATTACGTCTTACATGG + Intronic
1027140034 7:75650323-75650345 GCTCCAAATTACCACTTACAGGG - Intronic
1032842143 7:135722807-135722829 GCTCCTTATTAACTCTTACAGGG - Intronic
1042323768 8:67506572-67506594 GCTGCCAATTCCCACTTCCAAGG + Intronic
1045908421 8:107376291-107376313 GCTGCACGTTACCACATACATGG - Intronic
1047773018 8:128045706-128045728 GCTCCTCATTACGCCTTACAGGG - Intergenic
1048710769 8:137207759-137207781 GGTCCAAATGACCACCTAGAGGG + Intergenic
1049972335 9:832292-832314 GCTTCAAAATTCCTCTTACAAGG + Intergenic
1053950665 9:43374574-43374596 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1054059408 9:45254382-45254404 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1061385820 9:130288853-130288875 GCTCCAAATTTCCCCTACCAGGG - Intronic
1061755850 9:132812137-132812159 TCTCCAAATTCCCATTTACTGGG - Intronic
1062720966 9:138043766-138043788 GGTCCACGTTACCACCTACAAGG - Exonic
1203378299 Un_KI270435v1:1671-1693 ACTCCAAATGTCCACTTGCAGGG - Intergenic
1203414221 Un_KI270589v1:37902-37924 ACTCCAAATGTCCACTTGCAGGG + Intergenic
1203594003 Un_KI270747v1:104455-104477 GCTCCAAATGTCCACTTCCAGGG - Intergenic
1203683961 Un_KI270757v1:21966-21988 ACTCCAAATGTCCACTTGCAGGG - Intergenic
1186864434 X:13705502-13705524 ATTACAAATTACCACTTTCAAGG + Intronic
1187525700 X:20052706-20052728 GTTCCAAAGTCCCACTGACAAGG + Intronic
1188937183 X:36191078-36191100 ACTTAAAATTACCACTTAGAAGG + Intergenic
1190812997 X:53902792-53902814 GGACTTAATTACCACTTACATGG + Intergenic
1195312050 X:103641201-103641223 TCTCCAAATTACTATTTACCTGG + Intergenic
1197917185 X:131548763-131548785 GCTCCAAATGATCATTTCCATGG + Intergenic