ID: 1027141682

View in Genome Browser
Species Human (GRCh38)
Location 7:75662054-75662076
Sequence GAGTGAGCCACAAGGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027141682 Original CRISPR GAGTGAGCCACAAGGGGTGA AGG Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
901818190 1:11806717-11806739 CAGTGACCCAGAAAGGGTGAGGG - Intronic
902385205 1:16072400-16072422 GGGTAAGCTACTAGGGGTGATGG + Intronic
903869905 1:26426453-26426475 AATTGAGCCACAATGGGTGGGGG + Exonic
906060043 1:42942557-42942579 TAGGGAGCCACAGGGGGTGAAGG - Intronic
906097253 1:43232611-43232633 GAGAGAGACAGAAGGTGTGAGGG + Intronic
906715282 1:47964247-47964269 GAGTCAGGCCCAAGGGGTCAAGG + Intronic
907514304 1:54983593-54983615 GAGTGAGCCCAAAAAGGTGAAGG - Intronic
907626828 1:56038771-56038793 GAGGGAGCCACATGGAGAGAAGG - Intergenic
909032678 1:70560777-70560799 TAGTGGGTCACTAGGGGTGATGG + Intergenic
909858716 1:80575523-80575545 TAGTGGGTCACTAGGGGTGATGG + Intergenic
910370849 1:86513669-86513691 TAGTGAATCACTAGGGGTGATGG - Intergenic
910630422 1:89347781-89347803 TAGTGGGTCACTAGGGGTGATGG - Intergenic
910773620 1:90853218-90853240 GAGTGAATCACAAGGTGTGAAGG + Intergenic
910851676 1:91655190-91655212 GAGGGACCCACAAGGAATGAGGG - Intergenic
910948422 1:92618227-92618249 TAGTGGGTCACTAGGGGTGATGG - Intronic
911108958 1:94163185-94163207 TAGTGGGTCACTAGGGGTGATGG + Intronic
913039241 1:115006877-115006899 TAGTGGGTCACTAGGGGTGATGG + Intergenic
913093974 1:115498754-115498776 GAGTGAGCACTGAGGGGTGAGGG - Intergenic
913570384 1:120114117-120114139 TAGTGAGCCACCAGGTGTGGTGG + Intergenic
914291188 1:146275094-146275116 TAGTGAGCCACCAGGTGTGGTGG + Intergenic
914328928 1:146648142-146648164 GAGTGTGCCAGATGGGTTGATGG + Intergenic
914552232 1:148725877-148725899 TAGTGAGCCACCAGGTGTGGTGG + Intergenic
915667466 1:157458158-157458180 TAGTGGGTCACTAGGGGTGATGG + Intergenic
915674311 1:157516083-157516105 GAGTGGGCCACAAAGTGTGAAGG - Intronic
915876160 1:159613842-159613864 GAGTGAACCAGAAGGGGCTATGG - Intergenic
917516344 1:175711575-175711597 GAATAAGCCACAAAGGGTGAGGG + Intronic
917842790 1:178995602-178995624 CTGTGTCCCACAAGGGGTGAGGG + Intergenic
919124171 1:193376473-193376495 TAGTGGGTCACTAGGGGTGATGG + Intergenic
919330408 1:196163376-196163398 TAGTGGGTCACTAGGGGTGATGG - Intergenic
920181652 1:204135520-204135542 GGGAGAGCCACAAGGGTTGGGGG - Intronic
921077679 1:211712764-211712786 GAGTCAGACACAAGGGGCGAGGG - Intergenic
922465896 1:225845478-225845500 GAGTGAGCTTGGAGGGGTGAGGG - Exonic
922780849 1:228251089-228251111 TAGTGGGTCACTAGGGGTGATGG + Intronic
923253371 1:232197931-232197953 TAGTGAATCACTAGGGGTGATGG + Intergenic
923882459 1:238118571-238118593 GGGTGAGGGACAAGGGGAGAGGG - Intergenic
924795396 1:247288929-247288951 GAGTGAGGGAAAAGGCGTGAAGG - Intergenic
1063384891 10:5609985-5610007 GAGTGAGCCAGCAGTGGAGAGGG - Intergenic
1064168568 10:13007970-13007992 GTGTGAACCACAAGGGGTGAGGG + Intronic
1064399333 10:15008094-15008116 GTGAGAGCCACAGGTGGTGAAGG + Intergenic
1064580358 10:16787322-16787344 GAGTGAGGAGGAAGGGGTGATGG - Intronic
1065822779 10:29541327-29541349 GACAGAGGCACAAGGGATGATGG + Intronic
1066049570 10:31621217-31621239 GAGTGAGACACAAGGGGTTATGG - Intergenic
1067026054 10:42845174-42845196 TAGTGGGTCACTAGGGGTGATGG + Intergenic
1067831699 10:49614388-49614410 GTGTGAGCCGGAAGGGGTGGGGG - Exonic
1068972024 10:62969027-62969049 GAGTGATCCAAAAGAGATGAAGG - Intergenic
1069192104 10:65504861-65504883 TAGTGAATCACTAGGGGTGATGG + Intergenic
1069932317 10:71891158-71891180 GAGGGAGGGACAAGGGCTGAAGG - Intergenic
1069969634 10:72155431-72155453 GAGGGACCCTCATGGGGTGATGG + Intronic
1071443650 10:85726532-85726554 GAGGGAGTCACAAGGGATGAAGG + Intronic
1071673717 10:87635916-87635938 TAATGAGTCACTAGGGGTGACGG + Intergenic
1071990931 10:91100264-91100286 GAGTGAGCCATCAGGGATCAGGG + Intergenic
1073008364 10:100341479-100341501 GAGAGAAGCAAAAGGGGTGAAGG + Intergenic
1073042840 10:100618974-100618996 GAGTGAGCTTTAGGGGGTGACGG - Intergenic
1073291790 10:102416797-102416819 GAGGGAGCAACACGGGGTGAGGG + Exonic
1075158993 10:120006210-120006232 CAGTGAGCAACAAAGGGGGAAGG + Intergenic
1076540417 10:131211021-131211043 GGGTGAGACAGAAGGGGAGATGG - Intronic
1076680166 10:132167733-132167755 GAGTGAGGGGTAAGGGGTGAGGG - Intronic
1076725794 10:132412432-132412454 GAGTGAGCCCCATGGAGTGCAGG - Intronic
1077119858 11:901888-901910 GGCTGGGCCCCAAGGGGTGAGGG + Intronic
1077860001 11:6169589-6169611 GTGGGAGCCACAAGTGCTGAGGG + Exonic
1079947626 11:26764111-26764133 AAGTGGGCCACAAGAGCTGATGG + Intergenic
1080647768 11:34199300-34199322 GAGTGAGGAACCAGGGGTGGTGG - Intronic
1082040727 11:47682694-47682716 AAGTGACACACAAGGGCTGAGGG - Intronic
1082897073 11:58203411-58203433 GTGAGAGCCACAAGTGGAGAAGG + Exonic
1082898209 11:58215493-58215515 GTGAGAGCCACAAGTGGAGAAGG - Exonic
1083252033 11:61474757-61474779 GTGTGAGCACCAAGGAGTGATGG - Intronic
1083591575 11:63898420-63898442 CAGTGTGCCAGAAGGGGAGATGG - Intronic
1085038364 11:73312826-73312848 GAGTGAGCCCCCAGGGCTGGGGG - Intronic
1085065902 11:73495448-73495470 GAGTGGGCCAGCAGTGGTGATGG - Intronic
1085447003 11:76607625-76607647 GAGTGTGCCCCAAGGGGTGTAGG - Intergenic
1086571141 11:88285854-88285876 GAGAGAGCCACTAAGGGTCAGGG + Intergenic
1087735085 11:101823557-101823579 GTGTGAGCCCCTAGGGGTTAGGG - Intronic
1088052818 11:105539088-105539110 GAGTCAGGCACAGTGGGTGATGG - Intergenic
1089216250 11:116836417-116836439 GGGTGAGACAGAAGGGTTGAGGG + Intronic
1090447111 11:126774034-126774056 GAGTGAACGCCAAGGGCTGAAGG + Intronic
1090646755 11:128772689-128772711 GAAAGAGGGACAAGGGGTGAGGG + Intronic
1092070321 12:5626526-5626548 GAGTGAGACCCAAGGAGCGAAGG + Intronic
1093964746 12:25312422-25312444 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1095507375 12:42911713-42911735 GAGTGAGAGACAAGAGGTCAGGG + Intergenic
1095976466 12:47943623-47943645 GAGTGAGAGAGAAGGGGTCATGG + Intergenic
1096369151 12:51054125-51054147 GAGAGAGCCTCTAGGGATGATGG - Intronic
1096749876 12:53751882-53751904 GAGTCAGCCGCAAGGAGAGAGGG - Intergenic
1099401049 12:82204269-82204291 TAGTGGGTCACTAGGGGTGATGG + Intergenic
1099632548 12:85168582-85168604 TAGTGGGTCACTAGGGGTGATGG + Intronic
1099736038 12:86567215-86567237 TACTGAGTCACCAGGGGTGATGG - Intronic
1101011485 12:100455090-100455112 GACTCAACAACAAGGGGTGATGG + Intergenic
1101743985 12:107523894-107523916 GTGTGGGCCACATGGTGTGAGGG - Intronic
1102956384 12:117061707-117061729 GAGTCAGGCACCAGTGGTGAGGG - Intronic
1104078226 12:125409217-125409239 GAGCCAGCCACAAGGGAAGAGGG + Intronic
1104301708 12:127570488-127570510 GAGTGAGAAAGAAGGAGTGAAGG + Intergenic
1104898028 12:132173743-132173765 GAGAGACCCACAAGGGCTGGGGG + Intergenic
1105251645 13:18704033-18704055 GAGGGAGCCACAAAGTGTTAAGG + Intergenic
1106386678 13:29292280-29292302 GAGTGGACAACAGGGGGTGACGG - Intronic
1106408650 13:29496055-29496077 GAGTGAGACATGAAGGGTGAAGG + Intronic
1106416374 13:29549349-29549371 GAGAGTGCCAGAGGGGGTGAAGG + Intronic
1109519226 13:63486288-63486310 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1110418528 13:75278610-75278632 GAGTGAACCCCAAGGAGTGTGGG + Intergenic
1112337598 13:98527713-98527735 GGGTGAGCCACAAGGGAGGTGGG + Intronic
1114483191 14:23047902-23047924 GAGTGAGCCCCACGGGGTCCAGG - Exonic
1114645824 14:24255545-24255567 GAGTGAGCCAGAGGGTCTGAGGG + Intronic
1116466433 14:45238765-45238787 CAGTGAGCCTCAACAGGTGATGG + Intronic
1118295027 14:64560627-64560649 TAGTGAGCCATGAGGAGTGAGGG + Intronic
1120274934 14:82361011-82361033 GAGTGAAACACAAGGGTTAAGGG - Intergenic
1121738446 14:96234954-96234976 GAGTGAGCCCCAAGAGGACAGGG + Intronic
1121778327 14:96605748-96605770 TAGTGAGCCACAAAGTGTGCAGG + Intergenic
1122252527 14:100449904-100449926 GAGTGAGGCAGAAGGGGAGCAGG - Intronic
1123426667 15:20176510-20176532 TAGTGGGTCACTAGGGGTGATGG + Intergenic
1123535898 15:21183037-21183059 TAGTGGGTCACTAGGGGTGATGG + Intergenic
1125415906 15:39452280-39452302 GATTGAGCAACAAAGTGTGAAGG + Intergenic
1126283806 15:46987748-46987770 TAGTGGGCCATTAGGGGTGATGG - Intergenic
1128514123 15:68331644-68331666 GAGAGTGCCAAAGGGGGTGATGG + Intronic
1129644990 15:77421049-77421071 GGGTGATCTTCAAGGGGTGAAGG - Intronic
1131658896 15:94492787-94492809 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1131724216 15:95204293-95204315 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1132092689 15:98958771-98958793 GAGTGAGCAGAAAGGGGAGAGGG - Exonic
1132248306 15:100314969-100314991 GAAGGAGGCACAAGGAGTGAGGG + Intronic
1136762032 16:32741470-32741492 GCGGGAGGCACAAGGGGTGGGGG + Intergenic
1136806068 16:33128918-33128940 GCGGGAGGCACAAGGGGTGGGGG - Intergenic
1136857580 16:33672995-33673017 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1137023809 16:35454454-35454476 GAGTGAGCCAGAAGAGGGGAAGG + Intergenic
1137571969 16:49572361-49572383 GAGTGAGGCACATGAGGTGAAGG + Intronic
1138159179 16:54737299-54737321 GAATAAGCCACAAGGAGTGGAGG + Intergenic
1138394400 16:56692773-56692795 TAGGGAGCCACAAAGGGTTAAGG + Intronic
1139163091 16:64534952-64534974 GAGTGAGCAGCAAAGGGGGAAGG - Intergenic
1140004638 16:71062801-71062823 GAGTGTGCCAGATGGGTTGATGG - Intronic
1141559335 16:84856544-84856566 TAGTGGGTCACTAGGGGTGAGGG + Intronic
1203119157 16_KI270728v1_random:1521478-1521500 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1144143663 17:12376350-12376372 GAGAGAGACAGATGGGGTGAAGG + Intergenic
1144627145 17:16849795-16849817 GAGTGGGCCACAGGGGTTTATGG + Intergenic
1144879292 17:18422917-18422939 GAGTGGGCCACAGGGGTTTATGG - Intergenic
1145152945 17:20521470-20521492 GAGTGGGCCACAGGGGTTTATGG + Intergenic
1145776006 17:27529435-27529457 GAGTCTGGCTCAAGGGGTGAGGG + Intronic
1147581286 17:41628480-41628502 GAGTGGGCCACAGGGGTTTATGG + Intergenic
1147944937 17:44075596-44075618 GAGTGGGCCCCAAGGGCAGATGG + Intronic
1148212023 17:45814353-45814375 GAGTCAGTCACAGGGGGTGAGGG - Intronic
1150431278 17:65119522-65119544 AAGTGAACCACAGTGGGTGAAGG - Intergenic
1152299495 17:79486731-79486753 GAGTGTCCTACAAAGGGTGAGGG + Intronic
1153685027 18:7537069-7537091 TAGTGGGTCACTAGGGGTGATGG + Intergenic
1153925310 18:9830473-9830495 TAGTGACCTCCAAGGGGTGACGG - Intronic
1154506359 18:15044365-15044387 TAGTGGACCACTAGGGGTGATGG - Intergenic
1155741752 18:29297820-29297842 TAGTGGGTCACTAGGGGTGATGG + Intergenic
1157114409 18:44849617-44849639 GACTGAGCCACAAGTGATGAAGG + Intronic
1157484329 18:48076282-48076304 GAGTGAGACTCAACGAGTGAAGG + Intronic
1157538186 18:48476680-48476702 GTGTGACCCACATGGGGTCAAGG - Intergenic
1157846233 18:51006484-51006506 TAGTGGGTCACTAGGGGTGATGG - Intronic
1158329629 18:56347283-56347305 TAGTGAGCCAAAAGGGGGAAAGG - Intergenic
1160092643 18:75841491-75841513 TAGTGGGTCACTAGGGGTGACGG - Intergenic
1160953401 19:1678564-1678586 GAGAGAGACACAAAGGGAGAGGG - Intergenic
1162262317 19:9543092-9543114 TAGTGAGACACAAGGGGAGGAGG - Intergenic
1163537864 19:17888056-17888078 CAGGGAGCCACAGAGGGTGACGG + Intronic
1166213803 19:41323278-41323300 GAGTGAGGCAGAAGGAGAGATGG - Exonic
1166292440 19:41871741-41871763 GAGTGAGCCACAAGGGCCCCTGG - Exonic
1167580995 19:50342766-50342788 GACTGAGTCATGAGGGGTGAGGG - Intronic
925106677 2:1298004-1298026 CAGAGAGCTGCAAGGGGTGACGG + Intronic
925584779 2:5453658-5453680 GAGTGAGCCCCAGAGGCTGATGG - Intergenic
926038607 2:9654890-9654912 GAGGGAGCCACTAGGGCTGCTGG + Intergenic
926826969 2:16915154-16915176 TAGTGAATCACTAGGGGTGATGG - Intergenic
926872616 2:17439977-17439999 GAGTAAGCATCCAGGGGTGATGG + Intergenic
927660627 2:24990151-24990173 TAGTGGGTCACTAGGGGTGATGG - Intergenic
927982951 2:27386360-27386382 GAGTGAACCCCAAGGGTTGAGGG + Intronic
929269624 2:39959312-39959334 TAGTGGGTCACTAGGGGTGATGG + Intergenic
936507410 2:113118418-113118440 CACTGAGCCACAAGGTCTGAGGG + Intronic
936641418 2:114316183-114316205 TAGTGGGTCACTAGGGGTGACGG - Intergenic
937765832 2:125659487-125659509 TAGTGGGTCACTAGGGGTGATGG - Intergenic
937802528 2:126097044-126097066 TAGTGGGTCACTAGGGGTGATGG - Intergenic
939842713 2:147207948-147207970 GAGTCAGCCAGAAGAGATGATGG + Intergenic
940870293 2:158854320-158854342 GTGAGAGCCACAGGTGGTGAAGG - Intronic
941668227 2:168262590-168262612 TAGTGGGTCACTAGGGGTGACGG - Intergenic
941956661 2:171212273-171212295 GAGGGGGCGGCAAGGGGTGAGGG - Intronic
942017995 2:171836538-171836560 GAGTGAGCCACAGAGGCTGATGG + Intronic
943081260 2:183261261-183261283 AATTGAGCCACAATGGGTGGAGG + Intergenic
944605271 2:201346807-201346829 GAATGAGCTATAATGGGTGAAGG - Intronic
944626083 2:201570097-201570119 GATTGAGCCTCAAGAGGTCAAGG + Intronic
946093119 2:217248429-217248451 GAGTGAGGGAGAAGGGGTGGGGG - Intergenic
946282031 2:218672509-218672531 GAGTGAGCCAGGCTGGGTGAGGG + Intronic
946533907 2:220606397-220606419 TAGTGGGTCACTAGGGGTGATGG + Intergenic
948017027 2:234699377-234699399 GAGTGAGCCACAAAGGCTCCAGG + Intergenic
948170794 2:235900478-235900500 TAGTGGGTCACTAGGGGTGATGG + Intronic
1169291747 20:4359004-4359026 GTGGGAGCCAGAAGGGGAGAGGG + Intergenic
1171399915 20:24866220-24866242 GAGTGAGCCACCATGGATGTGGG - Intergenic
1173168164 20:40700731-40700753 CTGGGAGCCACAAGGGGTGTGGG - Intergenic
1173589042 20:44210282-44210304 GAGCGAGGCACAAGGGATGCGGG + Intronic
1174428770 20:50452300-50452322 CAGTGGGCCAAAAAGGGTGATGG + Intergenic
1174478654 20:50815401-50815423 GAGTGGGGCACAGCGGGTGATGG - Intronic
1174563131 20:51445342-51445364 GAGAGAGCCACAAGGACTGCTGG - Intronic
1175848641 20:62074047-62074069 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1176069151 20:63217001-63217023 GAGTTAGCCACAAGGGTGGCAGG - Intergenic
1176120811 20:63453742-63453764 GAGTTGGCCACAGGGGGAGAAGG + Intronic
1176791494 21:13324658-13324680 TAGTGGACCACTAGGGGTGATGG + Intergenic
1177990292 21:28028657-28028679 TAGTGGACCACTAGGGGTGACGG - Intergenic
1178005835 21:28218945-28218967 TAGTGAATCACTAGGGGTGATGG + Intergenic
1179251348 21:39673882-39673904 GAGTGAGCCAAAAAGAGTGGAGG - Intergenic
1180035359 21:45245547-45245569 GAGTGAGGGTCAGGGGGTGAGGG + Intergenic
1181089084 22:20459789-20459811 GAGGGAGCCTCAAGAGGTCAGGG + Intronic
1182422165 22:30253941-30253963 GAGTGAGCTTCCTGGGGTGAGGG + Intergenic
1182468462 22:30532460-30532482 GTGTGAGGCTCAGGGGGTGAGGG + Intronic
1183262980 22:36807902-36807924 GAGTGAGTGGCAAGGGGTGGGGG + Intronic
1183868411 22:40722633-40722655 AACTGAGCCACAAGAGGTGGAGG - Intergenic
1184687404 22:46102861-46102883 GAGTGAGTCACCAGGTGTGAGGG + Intronic
1184700818 22:46171504-46171526 AAGGGTGCCAGAAGGGGTGAGGG + Intronic
1185205274 22:49534261-49534283 GAGGGAGGCGCAGGGGGTGACGG - Intronic
949482803 3:4510128-4510150 GAGTTAGCCACAAGTGGTGGTGG + Intronic
951856447 3:27202520-27202542 GAGTGAGCCGTATGGGGAGAAGG - Intronic
954511285 3:51128195-51128217 TAGTGGGTCACTAGGGGTGATGG + Intronic
955404596 3:58618142-58618164 GAGTGAGGCTCAAGGGGGGTAGG + Intronic
956651610 3:71509513-71509535 GAGTGAGGTACTGGGGGTGAGGG + Intronic
959998079 3:112699794-112699816 TAGTGAGTCACTAGGGGTAATGG - Intergenic
961710773 3:128826525-128826547 TAGTGGGTCACTAGGGGTGATGG + Intergenic
961918687 3:130403681-130403703 GTGTGTGCAACAGGGGGTGAGGG - Intronic
963379039 3:144505792-144505814 TAGTGGGTCACTAGGGGTGATGG + Intergenic
965855497 3:173082703-173082725 GAGAGAGGCACACGGGGTGAGGG - Intronic
966929041 3:184663894-184663916 GGGGGAGCCACGTGGGGTGAGGG + Intronic
968931653 4:3582553-3582575 GAGTGGTCCCCAAGGGGAGAGGG - Intronic
969450090 4:7268112-7268134 GACTGCCCCACAAGGGGAGAAGG - Intronic
970663165 4:18308623-18308645 CAGTGAGTCTCAAGGGATGATGG + Intergenic
970729699 4:19088523-19088545 TAGTGGGTCACTAGGGGTGATGG - Intergenic
972623146 4:40768804-40768826 GAGTGAGAAACAAGGGGTTGTGG - Intronic
974459207 4:62165743-62165765 TAGTGGGTCACTAGGGGTGATGG - Intergenic
974478844 4:62419327-62419349 TAGTGAGTCAATAGGGGTGATGG + Intergenic
974882823 4:67780573-67780595 GACTTAGCCAAAAGGGGTGATGG - Intergenic
977570716 4:98626609-98626631 GAGGGAGCCTGTAGGGGTGAAGG - Intronic
980090977 4:128442589-128442611 TAGTGGGTCACTAGGGGTGATGG - Intergenic
981873743 4:149516694-149516716 TAGTGAATCACTAGGGGTGATGG - Intergenic
983252729 4:165363137-165363159 GAGGGAGACACAGGGAGTGAAGG - Intronic
984438755 4:179738372-179738394 GAGTGAGACAGCAGGGGTCAGGG + Intergenic
985083175 4:186287301-186287323 GCGTGAGCCACCAGTGGTGCTGG - Intronic
986188379 5:5467478-5467500 GAGTGAAACACAAGAGTTGAGGG - Intronic
986803459 5:11285196-11285218 GAGGGGGCCTCAAGGGGAGATGG - Intronic
987466310 5:18275953-18275975 TAGTGGGTCACTAGGGGTGATGG - Intergenic
988107951 5:26773983-26774005 TAGTGGGTCACTAGGGGTGATGG - Intergenic
991330544 5:65488233-65488255 TAATGGGCCACTAGGGGTGATGG + Intergenic
993757686 5:91751405-91751427 GACTGTGCCACAAGGGATGGTGG - Intergenic
996350767 5:122539022-122539044 AAGAGAGCCCCAAGGGGTCATGG - Intergenic
996392013 5:122972300-122972322 TAGTGGGTCACTAGGGGTGATGG + Intronic
996908759 5:128632463-128632485 TGGTGAGTCACTAGGGGTGATGG + Intronic
997613910 5:135233282-135233304 GAGTGAGCCACAGGAGGGTAAGG + Intronic
997631554 5:135372765-135372787 GAGTCAGCCACGATGGGTGCTGG + Intronic
997768146 5:136525848-136525870 AAGTGAGCCACAGTGGCTGAGGG + Intergenic
998290127 5:140907061-140907083 TAGTGGGTCACTAGGGGTGATGG + Intronic
998811786 5:145973850-145973872 GAATGAGTAAAAAGGGGTGAGGG + Intronic
1000422679 5:161056389-161056411 TAGTGGGCCACCATGGGTGATGG + Intergenic
1001187957 5:169595262-169595284 GAGTGAGGCACAATGGATGAGGG - Intronic
1003426172 6:5999678-5999700 GAGGGAGACAGAAGGGGCGAGGG - Intronic
1006062540 6:31434684-31434706 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1006642659 6:35496947-35496969 GAGGGAGCCGCAAGGGGGGCCGG + Exonic
1008354863 6:50540553-50540575 GAGTGAGAGAAAAGGAGTGAGGG + Intergenic
1010325819 6:74560893-74560915 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1010495033 6:76523613-76523635 GAGTGAGCAGCCAGGGGTCATGG - Intergenic
1010938045 6:81884942-81884964 TAGTGAGTCACTGGGGGTGATGG + Intergenic
1011830239 6:91363421-91363443 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1013536575 6:111068001-111068023 GGGTGAGCCACACAGGGAGAGGG - Intergenic
1014257134 6:119172283-119172305 GAGTGAGGCATATGGGGGGAAGG + Intergenic
1015443081 6:133271071-133271093 TAGTGAATCACTAGGGGTGATGG + Intronic
1015685103 6:135850669-135850691 GACAGAGCCACAAGGGGGCATGG - Intergenic
1015903884 6:138096162-138096184 GCGTGAGCCACAAGAGGAAAGGG + Intronic
1017388382 6:153911663-153911685 TAGTGGGCCACTAGGGGTGATGG + Intergenic
1018534835 6:164809031-164809053 TAGTGGGTCACTAGGGGTGATGG + Intergenic
1019444167 7:1062546-1062568 GAGTAAGCCACGCGGGCTGAAGG + Intronic
1020396861 7:7726613-7726635 TAGTGGGTCACTAGGGGTGAGGG - Intronic
1022831374 7:34070514-34070536 GGGTGTGCAAAAAGGGGTGAAGG - Intronic
1024733429 7:52277195-52277217 GATTGAGCCAGTAAGGGTGAGGG - Intergenic
1027141682 7:75662054-75662076 GAGTGAGCCACAAGGGGTGAAGG + Intronic
1029714517 7:102318689-102318711 CACTGAGCCACTAGGGGTTAGGG - Intronic
1032506702 7:132440727-132440749 GAGTCAACCAGAAGGGGTCAAGG + Intronic
1033232767 7:139614486-139614508 GAGGGAGCCTAAAGGAGTGATGG + Exonic
1036450607 8:8863945-8863967 GAGGCAGCCATAATGGGTGAAGG - Intronic
1039930241 8:41979964-41979986 GAGTGAGACTCCATGGGTGAGGG + Intronic
1040338088 8:46426342-46426364 GAGCGAGCCACAGGGACTGAGGG + Intergenic
1041935506 8:63327488-63327510 TAGTGAATCACTAGGGGTGATGG - Intergenic
1043163460 8:76874009-76874031 GAGAGAGAGAGAAGGGGTGAAGG - Intergenic
1044428900 8:92085828-92085850 GAGTGAGCAATAAGGATTGACGG + Intronic
1044895867 8:96890829-96890851 TAGTGGGTCACTAGGGGTGATGG + Intronic
1045749077 8:105459993-105460015 GATTTAGGAACAAGGGGTGAGGG - Intronic
1047508385 8:125497589-125497611 GAGGCAGCCAGAAGGGGTGGGGG + Intergenic
1048214576 8:132482284-132482306 GGGTGAGAGACATGGGGTGAGGG + Intergenic
1049110328 8:140638146-140638168 GAGAGAGAAAGAAGGGGTGAGGG + Intergenic
1049316258 8:141970210-141970232 GAGTGAGCCACAGGGGTGGGGGG - Intergenic
1049601095 8:143508037-143508059 GTGTGTGCCACATGGGTTGAGGG - Intronic
1049879330 8:145051705-145051727 GAGTGGGGCACATGGGGTGGAGG - Intergenic
1054458472 9:65449374-65449396 GAGTGGTCCCCAAGGGGAGAAGG + Intergenic
1056525895 9:87442739-87442761 TAGTGGGTCACTAGGGGTGATGG + Intergenic
1056655093 9:88502650-88502672 GAGTGAGGAACAAGGGGAGGAGG - Intergenic
1057059181 9:91988025-91988047 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1060069155 9:120531348-120531370 GAGTGGGGCACTAGGGGTGCAGG - Intronic
1060294117 9:122331650-122331672 GAGAGACCCACAAGGGAGGAGGG + Intergenic
1060416789 9:123436241-123436263 GAGGGAGCTGGAAGGGGTGATGG - Intronic
1061358098 9:130121650-130121672 CAGTGAGCCACAGTGGGAGAAGG - Intronic
1061917019 9:133760607-133760629 GAGGCAGCCACAAGGAGGGAAGG + Intergenic
1062135724 9:134926814-134926836 TAGTGGGTCACTAGGGGTGATGG - Intergenic
1186215496 X:7296102-7296124 GACTGAGCCACAAGGGAGGGAGG - Intronic
1186338130 X:8614133-8614155 GAGTAAGGAACTAGGGGTGAAGG - Intronic
1189519257 X:41748704-41748726 GAGGGACCCAGAAGGGATGAGGG + Intronic
1190155196 X:47985719-47985741 TAGTGGGTCACTAGGGGTGATGG - Intronic
1192424087 X:71060306-71060328 GTGGGAGCCACAAAGGGAGAGGG + Exonic
1193978267 X:88150253-88150275 GAGTGAGCCTCAAGGTTTCATGG + Intergenic
1194179402 X:90694446-90694468 TAGTGGGTCACTAGGGGTGATGG + Intergenic
1197808056 X:130416166-130416188 GAGCGAACCACAAGGTCTGAAGG - Intergenic
1197808377 X:130418514-130418536 GAGCGAACCACAAGGTCTGAAGG - Intergenic
1198960267 X:142175350-142175372 GAGTGAGCAGGAAGGGGTGGAGG - Intergenic
1200116233 X:153770882-153770904 GAGTGAGCCATCAGGAGGGAAGG + Exonic
1200224751 X:154411422-154411444 GCGGGAGCCCCACGGGGTGACGG + Intronic
1200526067 Y:4276619-4276641 TAGTGGGTCACTAGGGGTGATGG + Intergenic