ID: 1027146395

View in Genome Browser
Species Human (GRCh38)
Location 7:75698113-75698135
Sequence TGATAGTTATAAAACTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027146395 Original CRISPR TGATAGTTATAAAACTGGGC TGG (reversed) Intronic
906768351 1:48457909-48457931 CAATAATTATAAAACTGTGCTGG + Intronic
911699112 1:100930077-100930099 GGATAATTATAAAACTAAGCAGG + Intronic
912628334 1:111224882-111224904 TGAAATTTAAAAAATTGGGCTGG - Intronic
912763015 1:112385862-112385884 AAATTGTTATAAAACTGGACTGG + Intergenic
913421362 1:118673336-118673358 TGATAGTTATATAGCTGGGAAGG + Intergenic
917051913 1:170933784-170933806 CAATAATTATAAAACTGGGTTGG + Intergenic
917529464 1:175821766-175821788 TGAGAATTAGAAACCTGGGCTGG - Intergenic
917637107 1:176948126-176948148 TTATAGTCATAAAACTAGGCTGG - Intronic
923311406 1:232739081-232739103 TAATAATTTTAAAACTGGGCTGG - Intergenic
924349615 1:243102078-243102100 TTAAAATTATAAAACTTGGCTGG + Intergenic
1064353898 10:14601061-14601083 GGATATTTAAAGAACTGGGCTGG - Intronic
1065916674 10:30358955-30358977 AGATATTTATAGAACAGGGCAGG - Intronic
1069134032 10:64741846-64741868 GGATTGTTATAAAAGTGAGCTGG + Intergenic
1069330982 10:67292564-67292586 TTATAGATATAAAAATGGGAGGG - Intronic
1071741330 10:88361663-88361685 TCATAATGATAGAACTGGGCTGG - Intronic
1072276012 10:93824309-93824331 TAAAATTTATTAAACTGGGCTGG + Intergenic
1072847572 10:98849224-98849246 TGAAAGTTATTTAACTGGGAGGG - Intronic
1075503900 10:123004990-123005012 TAATAATTCTGAAACTGGGCTGG + Intronic
1079904470 11:26228323-26228345 TGAAAGTTTTAAAATTGGACTGG + Intergenic
1082080328 11:48007797-48007819 GGTCACTTATAAAACTGGGCAGG + Intronic
1083925990 11:65806923-65806945 TGATGGTTATAGAAATGGGCTGG + Intergenic
1085326635 11:75611278-75611300 TGCTAGTTCTGAAAGTGGGCAGG - Intronic
1087539066 11:99491691-99491713 TAATAGTTAGATAACTGGCCTGG - Intronic
1088849515 11:113693528-113693550 TGTTTGTTATAAAACTTGGAGGG - Intronic
1097892301 12:64789711-64789733 TCCTTGTTTTAAAACTGGGCTGG + Intronic
1100402663 12:94245808-94245830 CGATAGCTGTAAAACTGAGCTGG + Intronic
1103109018 12:118258416-118258438 TGAGAGTTCAAAAACTGGCCGGG + Intronic
1107595335 13:41957669-41957691 TGATAATTATAAATTTGGGTGGG + Intronic
1108443557 13:50481857-50481879 TGACAGCTATAAAAATAGGCAGG + Intronic
1109930982 13:69217013-69217035 TAACAGTTATTAAACTGAGCTGG - Intergenic
1109948116 13:69464506-69464528 TGATAGTAATGAAATTGTGCTGG - Intergenic
1110222375 13:73087156-73087178 AGATTGTTATAAAAATGGGAAGG + Intergenic
1112403851 13:99100517-99100539 TAAAAATTATAAAACTAGGCCGG + Intergenic
1112677265 13:101716532-101716554 TCACATTTTTAAAACTGGGCAGG + Exonic
1112875183 13:104028702-104028724 TCATTGTTATAGAAATGGGCAGG + Intergenic
1113329790 13:109317044-109317066 GGATAGTTAAATAAATGGGCTGG - Intergenic
1114305582 14:21420039-21420061 TGAAAGTTATCACACTGGGCAGG + Intronic
1119374914 14:74182688-74182710 TGTTAGCTATCAAACTGGCCTGG + Intronic
1119875993 14:78059909-78059931 TAATATCTTTAAAACTGGGCTGG + Intergenic
1124119802 15:26879282-26879304 CAATAGTTACACAACTGGGCAGG + Intronic
1126422704 15:48491645-48491667 AGGTAGTTAAAAAAGTGGGCCGG - Intronic
1126638540 15:50802622-50802644 TGAAAGTTATAAATCAGGCCAGG + Intergenic
1126664656 15:51065572-51065594 TGATGGTTATAAAACATGACAGG + Intronic
1129210521 15:74065416-74065438 AGATATTTATAGAACAGGGCAGG - Intergenic
1129403491 15:75299962-75299984 AGATATTTATAGAACAGGGCAGG + Intergenic
1129727721 15:77910051-77910073 AGATATTTATAGAACAGGGCAGG - Intergenic
1130473902 15:84247253-84247275 TTATAGCTATAGAACAGGGCAGG + Intergenic
1131101920 15:89698178-89698200 TAATAATGATAAAAGTGGGCCGG - Intronic
1131207870 15:90466793-90466815 TAAAAATTAAAAAACTGGGCCGG + Intronic
1136318750 16:29468903-29468925 TGAGAGCCATGAAACTGGGCTGG + Intergenic
1136433322 16:30208247-30208269 TGAGAGCCATGAAACTGGGCTGG + Intronic
1136496685 16:30649464-30649486 TGAAAGTGATAAAACAGGGCCGG - Intergenic
1140078058 16:71720412-71720434 TTAAAAGTATAAAACTGGGCTGG - Intronic
1140494619 16:75373955-75373977 TGAAAATTATAGAACTGGCCAGG + Intronic
1140912206 16:79464501-79464523 TGACATTTAAAAATCTGGGCAGG - Intergenic
1143747823 17:9006229-9006251 TGCGAATTGTAAAACTGGGCAGG + Intergenic
1146235234 17:31153913-31153935 TTATAGTTACAAAACTGGTTGGG - Intronic
1149009136 17:51836751-51836773 TGAATGTTATAAAACTGTGATGG + Intronic
1149611235 17:57959024-57959046 TGTTATTAATAAAACTTGGCTGG - Intergenic
1149617444 17:58013172-58013194 TGCTTGTTAAAAAACTGTGCTGG + Intergenic
1149759070 17:59213140-59213162 TGAAAGTTATAAGACTTAGCAGG - Exonic
1150602070 17:66659762-66659784 TGATTGTTATCACACTGTGCTGG + Intronic
1152984388 18:308488-308510 AGATAGATATTAAAGTGGGCGGG + Intergenic
1153274164 18:3351856-3351878 TTATTATTATAAAAATGGGCTGG + Intergenic
1156223054 18:35073697-35073719 TGTTAGTTTTAATACTGAGCTGG - Intronic
1156366685 18:36434731-36434753 TGAAAATTATAAAACTTTGCAGG - Intronic
1160367270 18:78337096-78337118 AGCAGGTTATAAAACTGGGCAGG - Intergenic
1161450998 19:4345341-4345363 TAATAGTAATAATACAGGGCTGG - Intronic
1162816959 19:13201610-13201632 TTAAAGTGATAAAACAGGGCCGG - Intergenic
1162863338 19:13524941-13524963 GAATAATAATAAAACTGGGCTGG - Intronic
1163749467 19:19067114-19067136 TGATAGTAAGATAACTGAGCTGG - Intronic
1165236222 19:34423783-34423805 TGATAATTATGATACTGGCCAGG - Intronic
925366116 2:3313357-3313379 TGAGAGTTAAAAAAGTGGGTGGG + Intronic
925862088 2:8188847-8188869 AAATAATTATACAACTGGGCAGG + Intergenic
930694690 2:54399611-54399633 TGAAGGTTAGAAAACTGGGAAGG - Intergenic
931773782 2:65522586-65522608 TGAAAGTTTAAAAAATGGGCTGG + Intergenic
935104186 2:100024277-100024299 TTATAATTATAAAACAGGCCGGG + Intronic
941826330 2:169901343-169901365 AGATAGTTTTAGAACTTGGCTGG - Intronic
942701372 2:178714892-178714914 TGCTAGTGATAAGACTGGGCTGG + Intronic
944930343 2:204511151-204511173 TTATGGTTATAAAATTGTGCAGG + Intergenic
946548133 2:220768685-220768707 TTAAAATGATAAAACTGGGCAGG + Intergenic
947258364 2:228191581-228191603 TGATAGTCATAAAACTTGAAGGG + Intergenic
1170045299 20:12079047-12079069 TGATACACATAAAACTGAGCAGG + Intergenic
1170187206 20:13604075-13604097 TTATAGCTAAAAAACTGGGTAGG - Intronic
1171937585 20:31289893-31289915 TCATATTTATAAAATTAGGCTGG - Intergenic
1175103145 20:56594562-56594584 TTATAATTAAAAAACTAGGCGGG + Intergenic
1177160231 21:17539320-17539342 CGACAGTTTTAAAGCTGGGCTGG - Intronic
1177842193 21:26246821-26246843 TGAAAGCTACAAGACTGGGCAGG - Intergenic
1178317322 21:31577630-31577652 AGTGACTTATAAAACTGGGCTGG + Intergenic
1178972308 21:37191464-37191486 TGATAGTTATAATTCTCGGGAGG + Intronic
1183764656 22:39861241-39861263 AAACAGTCATAAAACTGGGCTGG + Intronic
1184175718 22:42787732-42787754 AGATATTTATAGAACAGGGCAGG + Intergenic
1184447405 22:44557327-44557349 TAATAATTATAAAACTGGAGGGG + Intergenic
951340218 3:21476973-21476995 TGGTGGTTATAAAAATGGGTGGG - Intronic
951477005 3:23117812-23117834 TGAGATTTGTAAAACTGGGAAGG + Intergenic
952599642 3:35064930-35064952 GGGTTGTGATAAAACTGGGCTGG - Intergenic
953618902 3:44515490-44515512 TGTTAATGAGAAAACTGGGCAGG - Intergenic
954202381 3:49031475-49031497 TGATATTTAAAAAAATGGGCAGG + Intronic
956582526 3:70830460-70830482 GCATAGAAATAAAACTGGGCTGG - Intergenic
957326145 3:78697476-78697498 TGGTAGTTATAAAAATTGGCTGG - Intronic
958426595 3:93985642-93985664 TAATATTTATAAAACCTGGCAGG - Intronic
960611779 3:119561228-119561250 TGAAATTTCTAAAACTCGGCTGG - Intergenic
962959916 3:140301228-140301250 TGATAGCTATAACACTGTGATGG - Intronic
963348051 3:144119580-144119602 TCATGATTATAAAACAGGGCGGG - Intergenic
964715137 3:159713939-159713961 TAATATTTAAATAACTGGGCAGG + Intronic
966306748 3:178544574-178544596 AGATACTTATAATACTGGACAGG + Intronic
966330956 3:178812572-178812594 TGAAATTTAGAAAACTGTGCAGG - Intronic
966383917 3:179373967-179373989 TAAAATTTATAAAATTGGGCCGG - Intronic
970725692 4:19041751-19041773 AGATGGTTATAAACCTGGGGAGG - Intergenic
971075360 4:23141747-23141769 TGATAGTTATACATCTGGAAGGG - Intergenic
973291778 4:48477940-48477962 TGATTGTTAGAAAACTGAGATGG - Intergenic
975425322 4:74218750-74218772 TGCTAGTTAGAAAACTGCTCAGG + Intronic
977256021 4:94740854-94740876 TGAAAGTGATGAAACTGGTCTGG - Intergenic
977297154 4:95223630-95223652 TAATATTTATAAAACTGAGTAGG - Intronic
978390582 4:108221114-108221136 TGATAATTATAAAACTTGGGTGG + Intergenic
979252323 4:118578481-118578503 TTAAAATTATAAAACTTGGCTGG - Intergenic
979577668 4:122314512-122314534 TGCTTGTTATAAAATTGGACAGG + Intronic
985925506 5:3012956-3012978 TCCTAGTTATAAAACTGCCCAGG - Intergenic
987462397 5:18228113-18228135 TGATAATTATAAGACTAGGAAGG + Intergenic
987773419 5:22335337-22335359 TGATGGTTTTAAAAATGGGTGGG + Intronic
988235740 5:28541354-28541376 TGGTAGTTTTAAAACAGAGCGGG - Intergenic
989052795 5:37338022-37338044 TTAAAATTATAAAACCGGGCTGG + Intronic
991130998 5:63122211-63122233 TGATAATTATCACACAGGGCTGG + Intergenic
993053432 5:82952415-82952437 TGATAGGTGTTAAACAGGGCAGG - Intergenic
993746969 5:91612308-91612330 TGTTGGTTATAAAAATGGTCTGG + Intergenic
993853201 5:93037141-93037163 TGACATTTAAAAAACTGAGCTGG - Intergenic
995680289 5:114710063-114710085 TGATAGGTATAGAACTGGCTTGG - Intergenic
1000844400 5:166261196-166261218 TGAAAGTTATAGAAGTGTGCAGG + Intergenic
1002395692 5:178951921-178951943 TGATAGTTTCAAATTTGGGCAGG - Intronic
1003114561 6:3275060-3275082 TTATAGTTTTGAAACTGGGAAGG - Intronic
1006537968 6:34715538-34715560 TGAAAGTTATAGAGCTTGGCCGG - Intergenic
1008337355 6:50323802-50323824 TGTTAGTTATAAAACTAGAAGGG - Intergenic
1009982944 6:70747096-70747118 TCATAGTTAAAATACTGGCCTGG + Intronic
1012667178 6:101986842-101986864 TCTTAGTTTTAAAACTGGCCGGG + Intronic
1013269174 6:108529908-108529930 TGATAGTTGGAAAACTGAACAGG - Intergenic
1013713655 6:112931801-112931823 TGTTTGCTATAAAAGTGGGCTGG - Intergenic
1016781221 6:147961119-147961141 AGATAATTTTATAACTGGGCAGG + Intergenic
1017907611 6:158767723-158767745 TGGTAGTTTTAAAACTGCCCAGG - Intronic
1018276095 6:162133180-162133202 TGATAGGAATAGGACTGGGCAGG + Intronic
1020233419 7:6337415-6337437 TGAGAATTAAAATACTGGGCGGG - Intronic
1023104490 7:36750234-36750256 TAAAAGTTATAAATCTAGGCAGG + Intergenic
1023949273 7:44829086-44829108 TCATAGGCATAACACTGGGCAGG + Intronic
1024334482 7:48192490-48192512 TGATAGTTATAAATCTTGTTTGG + Intronic
1025270748 7:57511667-57511689 TAAAAGTTATAAAGCTGGGATGG - Intergenic
1027146395 7:75698113-75698135 TGATAGTTATAAAACTGGGCTGG - Intronic
1027588979 7:80093738-80093760 TCATTGTTAGAAAACTTGGCCGG + Intergenic
1031450621 7:121913608-121913630 TAATATTTATAAAACTAGCCAGG - Intronic
1032006476 7:128305867-128305889 TGAGAGGAATAAAACTGGACAGG + Exonic
1033890802 7:146010944-146010966 TGATGGTTCTTTAACTGGGCAGG - Intergenic
1036932599 8:12970675-12970697 TGATACTTTTTAAACTTGGCTGG - Intronic
1037566287 8:20120997-20121019 TAAAAATAATAAAACTGGGCTGG + Intergenic
1038316838 8:26491491-26491513 TTCTAGTTGTAAAAGTGGGCTGG - Intronic
1039507104 8:38060014-38060036 TGAAAGTGATCATACTGGGCAGG + Exonic
1039776997 8:40746649-40746671 TATTAGTAGTAAAACTGGGCCGG - Intronic
1040521643 8:48181488-48181510 TGATAGTCATAAGACTGTTCAGG + Intergenic
1044242079 8:89900312-89900334 TGATGGTTACAAGGCTGGGCAGG + Intergenic
1045093722 8:98774607-98774629 TAATAGTAATTAAACTTGGCAGG - Intronic
1046568485 8:115931848-115931870 TGACAGCTATAACACTGGGTAGG - Intergenic
1047123895 8:121938413-121938435 TGAAAGTTATAAAATAAGGCAGG - Intergenic
1047717570 8:127609831-127609853 TGGTAGTTTTAAAACATGGCTGG - Intergenic
1050650643 9:7772210-7772232 TGATGCTTATAACACTGGACTGG + Intergenic
1052002827 9:23307620-23307642 TGATAGATATAAAAAAGGACAGG + Intergenic
1052803761 9:32994013-32994035 TGAAAGATATAGAGCTGGGCCGG - Intronic
1052918939 9:33947519-33947541 TGATAGTTAAAATACTGTCCAGG + Intronic
1055433219 9:76266031-76266053 TGAAAGTCTTAAAAATGGGCAGG - Intronic
1056990731 9:91407658-91407680 TGAAAGTTATAAAGCAGGGAAGG - Intergenic
1059645648 9:116264161-116264183 TGATAATTCTAAAACTGGAGTGG - Intronic
1186107265 X:6221031-6221053 TGAAAGTTATAAAGTTGGCCAGG - Intronic
1186359712 X:8827863-8827885 TGATAAGAATGAAACTGGGCTGG + Intergenic
1186457166 X:9718798-9718820 TGTTAGGTAGAAACCTGGGCTGG + Exonic
1186857072 X:13636762-13636784 AGAAAGTTATACAACTGTGCAGG + Intergenic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1189297161 X:39926963-39926985 TGATAGTTATAAGACTACACTGG + Intergenic
1193099977 X:77599071-77599093 TGATAGTTTTAAAAATGAGTAGG - Intronic
1195899736 X:109785206-109785228 TGTCAGTTATAAAACTGAACTGG + Intergenic
1197327052 X:125106965-125106987 TGATAGTCAGAAAACTAGCCTGG + Intergenic
1199871842 X:151905049-151905071 TGATTGTTCCAAAAGTGGGCTGG + Intergenic
1200868716 Y:8074354-8074376 TTATAGGCATAAAACTAGGCAGG + Intergenic
1202367834 Y:24179105-24179127 AGCTATTTATAGAACTGGGCAGG + Intergenic
1202377006 Y:24246803-24246825 AGCTATTTATAGAACTGGGCAGG - Intergenic
1202493774 Y:25423318-25423340 AGCTATTTATAGAACTGGGCAGG + Intergenic
1202502949 Y:25491012-25491034 AGCTATTTATAGAACTGGGCAGG - Intergenic