ID: 1027152053

View in Genome Browser
Species Human (GRCh38)
Location 7:75739566-75739588
Sequence CCGCGGGGCTGCGCTTTCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027152053_1027152067 11 Left 1027152053 7:75739566-75739588 CCCGGGAAAGCGCAGCCCCGCGG No data
Right 1027152067 7:75739600-75739622 CGTGGGCGCCTGGCCGGATCCGG No data
1027152053_1027152071 23 Left 1027152053 7:75739566-75739588 CCCGGGAAAGCGCAGCCCCGCGG No data
Right 1027152071 7:75739612-75739634 GCCGGATCCGGCTCAATGGGTGG No data
1027152053_1027152070 20 Left 1027152053 7:75739566-75739588 CCCGGGAAAGCGCAGCCCCGCGG No data
Right 1027152070 7:75739609-75739631 CTGGCCGGATCCGGCTCAATGGG No data
1027152053_1027152066 5 Left 1027152053 7:75739566-75739588 CCCGGGAAAGCGCAGCCCCGCGG No data
Right 1027152066 7:75739594-75739616 GCGCAGCGTGGGCGCCTGGCCGG No data
1027152053_1027152064 -6 Left 1027152053 7:75739566-75739588 CCCGGGAAAGCGCAGCCCCGCGG No data
Right 1027152064 7:75739583-75739605 CCGCGGGCGGGGCGCAGCGTGGG No data
1027152053_1027152069 19 Left 1027152053 7:75739566-75739588 CCCGGGAAAGCGCAGCCCCGCGG No data
Right 1027152069 7:75739608-75739630 CCTGGCCGGATCCGGCTCAATGG No data
1027152053_1027152065 1 Left 1027152053 7:75739566-75739588 CCCGGGAAAGCGCAGCCCCGCGG No data
Right 1027152065 7:75739590-75739612 CGGGGCGCAGCGTGGGCGCCTGG No data
1027152053_1027152062 -7 Left 1027152053 7:75739566-75739588 CCCGGGAAAGCGCAGCCCCGCGG No data
Right 1027152062 7:75739582-75739604 CCCGCGGGCGGGGCGCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027152053 Original CRISPR CCGCGGGGCTGCGCTTTCCC GGG (reversed) Intergenic