ID: 1027156375

View in Genome Browser
Species Human (GRCh38)
Location 7:75771211-75771233
Sequence GTACAACTCCACCAATTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027156369_1027156375 13 Left 1027156369 7:75771175-75771197 CCTGGGCTCAAGCGATCGTCTAA 0: 1
1: 7
2: 522
3: 8043
4: 44514
Right 1027156375 7:75771211-75771233 GTACAACTCCACCAATTTAAAGG No data
1027156368_1027156375 22 Left 1027156368 7:75771166-75771188 CCTTGAACTCCTGGGCTCAAGCG 0: 490
1: 5250
2: 15151
3: 29485
4: 52535
Right 1027156375 7:75771211-75771233 GTACAACTCCACCAATTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027156375 Original CRISPR GTACAACTCCACCAATTTAA AGG Intronic
No off target data available for this crispr