ID: 1027157265

View in Genome Browser
Species Human (GRCh38)
Location 7:75777536-75777558
Sequence CCAGGCTTGTCTCCAACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112068
Summary {0: 1, 1: 97, 2: 3323, 3: 39401, 4: 69246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027157265 Original CRISPR CCAGGCTTGTCTCCAACTAC TGG (reversed) Intronic
Too many off-targets to display for this crispr