ID: 1027160046

View in Genome Browser
Species Human (GRCh38)
Location 7:75795806-75795828
Sequence TCTGCCATCCATGAGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027160046_1027160049 -4 Left 1027160046 7:75795806-75795828 CCACAAAACTCATGGATGGCAGA No data
Right 1027160049 7:75795825-75795847 CAGAACCAAGGCTCAGAGCTGGG No data
1027160046_1027160048 -5 Left 1027160046 7:75795806-75795828 CCACAAAACTCATGGATGGCAGA No data
Right 1027160048 7:75795824-75795846 GCAGAACCAAGGCTCAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027160046 Original CRISPR TCTGCCATCCATGAGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr