ID: 1027168455

View in Genome Browser
Species Human (GRCh38)
Location 7:75852901-75852923
Sequence AGGGCTGATGCTCCTTTTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027168451_1027168455 -1 Left 1027168451 7:75852879-75852901 CCATAGTAGTATACCAAGGGGCA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1027168455 7:75852901-75852923 AGGGCTGATGCTCCTTTTATAGG 0: 1
1: 0
2: 1
3: 6
4: 112
1027168447_1027168455 14 Left 1027168447 7:75852864-75852886 CCACATAAAGGGTTACCATAGTA 0: 1
1: 0
2: 0
3: 6
4: 63
Right 1027168455 7:75852901-75852923 AGGGCTGATGCTCCTTTTATAGG 0: 1
1: 0
2: 1
3: 6
4: 112
1027168446_1027168455 15 Left 1027168446 7:75852863-75852885 CCCACATAAAGGGTTACCATAGT 0: 1
1: 0
2: 0
3: 11
4: 58
Right 1027168455 7:75852901-75852923 AGGGCTGATGCTCCTTTTATAGG 0: 1
1: 0
2: 1
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027168455 Original CRISPR AGGGCTGATGCTCCTTTTAT AGG Intronic
900002737 1:23793-23815 AGGGCTGCAGCTTCTTGTATTGG - Intergenic
903809291 1:26025920-26025942 AGGGCCCATGATACTTTTATAGG + Intronic
904605404 1:31695356-31695378 AGGGGTGAGGCTTGTTTTATAGG - Intronic
905381546 1:37565126-37565148 AGGGCTTATGATGATTTTATTGG - Exonic
908749921 1:67411900-67411922 AGTGGTGATGCTCCCATTATAGG + Exonic
910148651 1:84113861-84113883 GGGACTGAGGCTCCTTTTTTGGG + Intronic
912770665 1:112461768-112461790 AGGTCTGATGATCCATTTCTGGG - Intronic
915751030 1:158211397-158211419 AGGGGTGATGGTACTTTGATGGG + Intergenic
916657194 1:166886705-166886727 AAGGTTGAGGCTCCTATTATTGG - Intergenic
917857034 1:179109229-179109251 GGGGCTGATTCTCCATTTCTCGG + Exonic
919109679 1:193202150-193202172 GGGGCTAATGTTCCTTTTAATGG + Intronic
920700221 1:208212365-208212387 AGAGCTGCTGCTCCTGTTACTGG + Intronic
923346712 1:233060652-233060674 AGAGCTGATGTTCATTTGATTGG - Intronic
923841989 1:237682788-237682810 ATGGCACATGCTCCTTTTTTTGG - Intronic
1066638870 10:37535366-37535388 ATGGGTGCTGCTCATTTTATGGG - Intergenic
1067006806 10:42672292-42672314 AGGGCTGCAGCTCATCTTATTGG - Intergenic
1070337967 10:75471809-75471831 AGGCCAGCTGCTCCTTTTAGGGG - Intronic
1071011112 10:80941683-80941705 AGGATTGATGCTCCTGTTTTTGG - Intergenic
1071894031 10:90044955-90044977 AGAGCTGATACACATTTTATTGG - Intergenic
1074348507 10:112712018-112712040 GGTGCTGAGGCTCCTTTTACTGG - Intronic
1074966791 10:118497911-118497933 AGAGCTGATGCCACTTATATTGG - Intergenic
1075166634 10:120073863-120073885 TGGGCAGAAGCTCTTTTTATTGG - Intergenic
1078988238 11:16615020-16615042 GGGCCTGTTGCTTCTTTTATTGG - Intronic
1081173329 11:39894353-39894375 AGGTCTGATGCTGTTTTTAATGG - Intergenic
1083493236 11:63028280-63028302 AGGGCTGCAACTTCTTTTATAGG + Intergenic
1086240498 11:84684496-84684518 AGAGTTGATGCTGCTTTCATAGG - Intronic
1091960486 12:4690101-4690123 TGGGCTGAGTCTCCATTTATAGG + Exonic
1093281902 12:17204753-17204775 AGAGCTGAGGCTCCTTCTTTGGG + Intergenic
1100904048 12:99277278-99277300 AGGGGTGATCTTCCTTTCATTGG - Intronic
1102045711 12:109828897-109828919 AGGGCTGATGTTCATTTTGATGG - Intronic
1106543922 13:30714468-30714490 AGGGCAGATGCTCCATTTTGGGG + Intronic
1108575130 13:51784030-51784052 GGGGATGATGATACTTTTATAGG - Intronic
1109929687 13:69198613-69198635 GGGGCTGTTACTCCCTTTATTGG + Intergenic
1114666613 14:24381115-24381137 AGGGCAGATGCTCCTGTACTGGG - Intergenic
1116216707 14:42025640-42025662 AGAGCTGCTACTCCTATTATGGG - Intergenic
1120857021 14:89221724-89221746 AGAGGTGATGCTTCTTGTATTGG - Intronic
1123826486 15:24087163-24087185 TGGGCTGCTGCTCCTTTCAAGGG + Intergenic
1124384335 15:29194257-29194279 AAGGCTGTTGCTCCTTGCATAGG + Intronic
1125360665 15:38861239-38861261 AGGACTGAGGCTCCTCTTAGAGG + Intergenic
1132450774 15:101967146-101967168 AGGGCTGCAGCTTCTTGTATTGG + Intergenic
1133866131 16:9645159-9645181 GGGGCTTATGCTCCTTCTGTGGG + Intergenic
1138039037 16:53642403-53642425 AGTGTTGATACTCCTTTTAATGG + Intronic
1140221755 16:73048607-73048629 AGGCCTCAGGCTCCTTTTAGTGG - Intronic
1143388222 17:6544601-6544623 AGGGCTGAGGCTCATTTGAATGG + Intronic
1144951552 17:18997099-18997121 AGGCCTGATCTTCCTTTAATTGG - Intronic
1147894327 17:43740534-43740556 AGGTCTTATTCTGCTTTTATTGG - Intergenic
1149215018 17:54344607-54344629 AGTGCTATTGCTCCTTTTAAAGG - Intergenic
1156734381 18:40235539-40235561 AGGGCTGATGCTGCTTGTTCAGG + Intergenic
1158472099 18:57746290-57746312 AGGGCTTATCCTCATTTTGTGGG + Intronic
1160634488 19:65401-65423 AGGGCTGCAGCTTCTTGTATTGG - Intergenic
1165393634 19:35551993-35552015 AGGGCAGATGCCCCATTTAAAGG + Intronic
1167563337 19:50239898-50239920 AGGGCCTGTGCTCCTTTTATTGG - Intronic
929557231 2:42933098-42933120 AGGGCTGATACTTCTTTTAAGGG + Intergenic
930550937 2:52834052-52834074 AGGGCTCTTGCTTCTATTATAGG + Intergenic
931906553 2:66849381-66849403 GGGGCTGCTGCTCCTTCTCTTGG - Intergenic
934771363 2:96909598-96909620 GAGGCTGATGCTCATTTTCTTGG + Intronic
936566987 2:113589626-113589648 AGGGCTGCAGCTTCTTGTATTGG + Intergenic
940635412 2:156292780-156292802 AGGGCTGATGCAGCTTGTATAGG + Intergenic
941954529 2:171191231-171191253 AGGGCAGATCCTGATTTTATGGG - Intronic
943788523 2:191905889-191905911 AATGCAGATGCTGCTTTTATAGG + Intergenic
947374994 2:229486807-229486829 AGGGCTGATGCTGCTGATCTGGG - Intronic
948149543 2:235734106-235734128 AGGGCTGATTGTCCTTTTCAAGG + Intronic
1172691903 20:36796005-36796027 CTGGTTGAAGCTCCTTTTATCGG + Intronic
1175257831 20:57657643-57657665 AGGGCTGATGCTCCTTGCCCTGG + Intronic
1179571291 21:42280361-42280383 AGGGCTGAGGCTGCTTTGCTGGG - Intronic
1184055636 22:42046405-42046427 AGTGGTGATGCTCCCATTATAGG - Intronic
956080265 3:65549511-65549533 GCGGCAGCTGCTCCTTTTATGGG + Intronic
962176409 3:133160163-133160185 AGGGCTGCTGCTCCTTTTGTGGG + Intronic
967583127 3:191183578-191183600 ATGGCTGATGCTGCTTTTTGTGG - Intergenic
975657404 4:76655406-76655428 AGGACTGAAGGTCCTCTTATTGG - Intronic
976647431 4:87400446-87400468 AGGGCTGTGGCTCCTTTTTTGGG + Intergenic
980058969 4:128108113-128108135 AGGACTGCTACTCTTTTTATAGG + Intronic
981472312 4:145150642-145150664 AGTGCTGATGGGGCTTTTATTGG + Exonic
985201500 4:187489322-187489344 AGGCCTGAAGCTCCTTTGTTTGG + Intergenic
985808773 5:2068209-2068231 AGGGCTGAGGCTCCTGAGATGGG + Intergenic
986002582 5:3641971-3641993 AGGTATGAGGCTCCATTTATGGG + Intergenic
986395092 5:7321508-7321530 AGGGGAGATTCTCCTTTTCTGGG - Intergenic
988835270 5:35025880-35025902 AGGGCTGATGCTATTATTATAGG - Intronic
988950210 5:36249091-36249113 AGAGCAGATGCTCTTTTTAAAGG + Intronic
992624972 5:78628521-78628543 GGGGCTGCTGCTCCTTTGAGCGG - Intronic
1004561008 6:16750895-16750917 AGGGATGATACTCATTTTAACGG - Intronic
1009360999 6:62814291-62814313 CGGGCTGATGCTCCTATTTTAGG - Intergenic
1013376134 6:109516299-109516321 AGGGCTGTATTTCCTTTTATCGG - Intronic
1014808521 6:125858889-125858911 AGGTCTGATGCTCCATCTAGCGG - Intronic
1016521237 6:144949394-144949416 AAGAGTGATGCTCCTATTATAGG + Intergenic
1020914620 7:14177024-14177046 AGAGTTGAAGCTCCTTTCATTGG - Intronic
1027168455 7:75852901-75852923 AGGGCTGATGCTCCTTTTATAGG + Intronic
1027229730 7:76265203-76265225 ACTGCTGATGTACCTTTTATAGG + Intronic
1027395193 7:77746794-77746816 AGGTCTGTAGCTCCTTTTTTTGG - Intronic
1028838845 7:95404416-95404438 AGGGCTTATGATGATTTTATAGG + Intergenic
1032371502 7:131357815-131357837 AGAACTGTTGTTCCTTTTATTGG + Intronic
1035082292 7:156226869-156226891 AGGGCTGCTGCTCACTTTTTTGG - Intergenic
1037067840 8:14604591-14604613 AGGAATGATAATCCTTTTATAGG - Intronic
1041821793 8:62044225-62044247 GGAGCTCAGGCTCCTTTTATTGG + Intergenic
1041868664 8:62607391-62607413 AAGGCTGATGCACCTTCTCTTGG + Intronic
1043601527 8:81944465-81944487 TGGGCTGATTTTCCATTTATAGG - Intergenic
1043616724 8:82134492-82134514 AGGGATGATGGTACTTTGATGGG - Intergenic
1046121320 8:109851018-109851040 AGGGCCCATGCTCCTATAATTGG - Intergenic
1047004416 8:120604786-120604808 AGGTCTGATGCTTCTATTTTTGG - Intronic
1048279509 8:133094726-133094748 AGGGCTGATGGTTCTTTAAGAGG - Intronic
1049885542 9:23906-23928 AGGGCTGCAGCTTCTTGTATTGG - Intergenic
1052396640 9:27946909-27946931 TGGGCTTATCCTACTTTTATTGG + Intergenic
1052452244 9:28646363-28646385 ACGGCTAAAGCTCCTTTCATAGG + Intronic
1055507351 9:76962128-76962150 AGGGCTGAGGCTCTTCTGATAGG + Intergenic
1055623924 9:78152972-78152994 AGGGTTGAAGCTCATTTTTTTGG + Intergenic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1056972964 9:91223883-91223905 AGGCCTGAAGGTCCTTTTCTGGG - Intronic
1060262536 9:122089150-122089172 AGAGCTGTGTCTCCTTTTATGGG - Intronic
1061943698 9:133896617-133896639 AGGGCAGTTGCTCATTTCATTGG + Intronic
1189047148 X:37605534-37605556 AGGGCTGTTGCTCATCTTTTAGG - Intronic
1190759815 X:53430063-53430085 AGGGCTGATGCTGATTTAAGAGG - Intronic
1190926153 X:54907013-54907035 AGGGCTCTGGTTCCTTTTATTGG + Intergenic
1193061632 X:77213961-77213983 GGGGCTGATGCTCAATTTGTTGG - Intergenic
1193694681 X:84693734-84693756 AGTGATGATGTTCATTTTATGGG - Intergenic
1196291480 X:113946841-113946863 AGGGCTGATCCTTCATGTATTGG - Intergenic
1199259623 X:145756445-145756467 ATGGCTCTGGCTCCTTTTATTGG + Intergenic
1200011491 X:153123978-153124000 AGGGCCGTTGCTCCTATTCTAGG - Intergenic
1200028110 X:153275941-153275963 AGGGCCGTTGCTCCTATTCTAGG + Intergenic
1202385288 Y:24320465-24320487 AGGGCTGGTTCTCCTTCTAGAGG - Intergenic
1202485497 Y:25349663-25349685 AGGGCTGGTTCTCCTTCTAGAGG + Intergenic