ID: 1027171837

View in Genome Browser
Species Human (GRCh38)
Location 7:75878355-75878377
Sequence ATTTTAAAGGGCATTGTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027171832_1027171837 -3 Left 1027171832 7:75878335-75878357 CCAAGGAGTTCCGGGCTGGGATT 0: 1
1: 4
2: 14
3: 56
4: 336
Right 1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG No data
1027171831_1027171837 -2 Left 1027171831 7:75878334-75878356 CCCAAGGAGTTCCGGGCTGGGAT 0: 1
1: 2
2: 11
3: 37
4: 160
Right 1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG No data
1027171830_1027171837 -1 Left 1027171830 7:75878333-75878355 CCCCAAGGAGTTCCGGGCTGGGA 0: 1
1: 4
2: 10
3: 36
4: 208
Right 1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG No data
1027171825_1027171837 6 Left 1027171825 7:75878326-75878348 CCATCTTCCCCAAGGAGTTCCGG 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG No data
1027171823_1027171837 15 Left 1027171823 7:75878317-75878339 CCAACAAATCCATCTTCCCCAAG 0: 1
1: 0
2: 2
3: 32
4: 268
Right 1027171837 7:75878355-75878377 ATTTTAAAGGGCATTGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027171837 Original CRISPR ATTTTAAAGGGCATTGTGAA GGG Intronic
No off target data available for this crispr