ID: 1027171949

View in Genome Browser
Species Human (GRCh38)
Location 7:75878930-75878952
Sequence CGGATTGGACAACTTGGCAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 59}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027171934_1027171949 20 Left 1027171934 7:75878887-75878909 CCCACGCACGGGGGGGGGGGGGG 0: 1
1: 0
2: 2
3: 38
4: 348
Right 1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1027171925_1027171949 27 Left 1027171925 7:75878880-75878902 CCGGCCTCCCACGCACGGGGGGG 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1027171923_1027171949 28 Left 1027171923 7:75878879-75878901 CCCGGCCTCCCACGCACGGGGGG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1027171930_1027171949 23 Left 1027171930 7:75878884-75878906 CCTCCCACGCACGGGGGGGGGGG 0: 1
1: 0
2: 0
3: 11
4: 147
Right 1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG 0: 1
1: 0
2: 0
3: 3
4: 59
1027171936_1027171949 19 Left 1027171936 7:75878888-75878910 CCACGCACGGGGGGGGGGGGGGG 0: 1
1: 0
2: 8
3: 81
4: 893
Right 1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG 0: 1
1: 0
2: 0
3: 3
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027171949 Original CRISPR CGGATTGGACAACTTGGCAT GGG Exonic
912286192 1:108372168-108372190 TGAATTGGAGAACTTGGAATGGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
1074849951 10:117431863-117431885 TGGATTGGACACAGTGGCATTGG + Intergenic
1077777406 11:5286609-5286631 CTGAATGGATAACTTGGCCTGGG + Intronic
1095585367 12:43843746-43843768 AGGACTGGGCAACTTTGCATTGG - Intronic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1102515471 12:113443348-113443370 CTGATTGGACAGCTTGGCTCCGG - Intergenic
1104262643 12:127198559-127198581 GGGAGTGGTCAACTGGGCATGGG - Intergenic
1104984943 12:132591505-132591527 CTGATGGGACAAGCTGGCATCGG - Intergenic
1113811808 13:113147261-113147283 CGAAGAGGACAGCTTGGCATGGG + Intronic
1124991920 15:34683048-34683070 CTGAATGGACAACTTTGCTTTGG - Intergenic
1129424116 15:75452195-75452217 CGGATTGGATATCTTGGCGCTGG + Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1151235908 17:72719767-72719789 GGGATTGGACATCTTGGCACAGG - Intronic
1153784349 18:8521288-8521310 CTGATTGGACCACTGGGCACAGG + Intergenic
1163654540 19:18538163-18538185 CGGAGTGGACACCTTTGCAGGGG + Intronic
930594282 2:53366895-53366917 CGGCATGGACTACATGGCATAGG + Intergenic
930802509 2:55457536-55457558 CTGAATGGACAAATTGGCTTAGG + Intergenic
933719389 2:85387957-85387979 CGTATTGCACAATTTGGCAGTGG - Intronic
933916771 2:87002722-87002744 AGGGATGGACAACTTGGCACTGG - Intronic
934006223 2:87767192-87767214 AGGGATGGACAACTTGGCACTGG + Intronic
934232300 2:90195215-90195237 TGGATTGGACAGATAGGCATGGG - Intergenic
935769822 2:106407465-106407487 AGGGATGGACAACTTGGCACTGG + Intronic
935910271 2:107888458-107888480 AGGGATGGACAACTTGGCACTGG - Intronic
935968391 2:108505305-108505327 AGGGATGGACAACTTGGCACTGG - Intronic
936132060 2:109853598-109853620 AGGGATGGACAACTTGGCACTGG - Intronic
936212637 2:110517887-110517909 AGGGATGGACAACTTGGCACTGG + Intronic
936421775 2:112372467-112372489 AGGGATGGACAACTTGGCACTGG + Intronic
938620106 2:133042740-133042762 ATGTTTGGACAACTTGTCATTGG + Intronic
1176034464 20:63029415-63029437 TGGACTGGACAACTGGGCTTCGG + Intergenic
1177767999 21:25480489-25480511 GTGGTTGGCCAACTTGGCATTGG - Intergenic
949634487 3:5967771-5967793 TGTGTAGGACAACTTGGCATAGG + Intergenic
951085953 3:18512829-18512851 AGGATAGGAGAACTTGGGATAGG + Intergenic
964506414 3:157404920-157404942 CAGAAAGGACAACTGGGCATTGG - Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
979863660 4:125725605-125725627 GACATTGGACAACTTGGCAGAGG - Intergenic
990108138 5:52289818-52289840 CAGATGGTTCAACTTGGCATGGG + Intergenic
990893998 5:60677432-60677454 CGGATTGGAAAACATGTGATAGG + Intronic
993306238 5:86278926-86278948 TGAATTGGAAAACTTGGAATGGG + Intergenic
997588698 5:135059986-135060008 CAGTTTGGACATCATGGCATTGG + Intronic
1001968951 5:175938339-175938361 CAGAGTGGACCACTTGGCCTGGG - Intronic
1002248493 5:177905406-177905428 CAGAGTGGACCACTTGGCCTGGG + Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1007232804 6:40360401-40360423 GTGAATGGTCAACTTGGCATTGG + Intergenic
1008517348 6:52330579-52330601 TGCATTGGAAAACTTGTCATTGG + Intergenic
1009026835 6:58010311-58010333 CGTATCGGACAACTTGGTTTTGG - Intergenic
1009202380 6:60761783-60761805 TGTATTGGACAACTTGGTTTTGG - Intergenic
1013211382 6:107989985-107990007 AGGAATGGACATCGTGGCATCGG + Intergenic
1026513630 7:71048330-71048352 CAGATTGAGCAAATTGGCATGGG + Intergenic
1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG + Exonic
1032099965 7:128967151-128967173 TGAATTGCACAAATTGGCATTGG - Intronic
1034920505 7:155076440-155076462 AGCATTGAACAACTTGGCTTTGG + Intronic
1036287950 8:7461336-7461358 CTGATTGGACAACGTGGCCCCGG + Intronic
1036333526 8:7850192-7850214 CTGATTGGACAACGTGGCCCCGG - Intronic
1041343873 8:56875228-56875250 GGGATTGGACCAATTGGCCTGGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1052606881 9:30715366-30715388 CTGCTTGGGCAGCTTGGCATTGG + Intergenic
1058827017 9:108784025-108784047 TGGATTAGACAACTGGGGATTGG - Intergenic
1059651568 9:116320378-116320400 CTGATAAGATAACTTGGCATTGG - Intronic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1193712447 X:84895262-84895284 CCAATTAGAAAACTTGGCATGGG + Intergenic