ID: 1027185096

View in Genome Browser
Species Human (GRCh38)
Location 7:75966346-75966368
Sequence TTTCTGTTTTCACCAAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027185090_1027185096 28 Left 1027185090 7:75966295-75966317 CCCTGTCCGCAGAGACAGCTGCT 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1027185096 7:75966346-75966368 TTTCTGTTTTCACCAAAGACTGG No data
1027185091_1027185096 27 Left 1027185091 7:75966296-75966318 CCTGTCCGCAGAGACAGCTGCTG 0: 1
1: 0
2: 2
3: 21
4: 216
Right 1027185096 7:75966346-75966368 TTTCTGTTTTCACCAAAGACTGG No data
1027185093_1027185096 22 Left 1027185093 7:75966301-75966323 CCGCAGAGACAGCTGCTGGCTTC 0: 1
1: 0
2: 1
3: 30
4: 317
Right 1027185096 7:75966346-75966368 TTTCTGTTTTCACCAAAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027185096 Original CRISPR TTTCTGTTTTCACCAAAGAC TGG Intronic
No off target data available for this crispr