ID: 1027188581

View in Genome Browser
Species Human (GRCh38)
Location 7:75985530-75985552
Sequence GGGCAAGGGCCTCGGTGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027188570_1027188581 6 Left 1027188570 7:75985501-75985523 CCTGCAGAACGGGACTTGGGGCC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1027188581 7:75985530-75985552 GGGCAAGGGCCTCGGTGTGGCGG 0: 1
1: 0
2: 2
3: 33
4: 337
1027188564_1027188581 25 Left 1027188564 7:75985482-75985504 CCTGGGTGAGTGGGGCTGGCCTG 0: 1
1: 0
2: 9
3: 44
4: 446
Right 1027188581 7:75985530-75985552 GGGCAAGGGCCTCGGTGTGGCGG 0: 1
1: 0
2: 2
3: 33
4: 337
1027188563_1027188581 26 Left 1027188563 7:75985481-75985503 CCCTGGGTGAGTGGGGCTGGCCT 0: 1
1: 0
2: 2
3: 34
4: 267
Right 1027188581 7:75985530-75985552 GGGCAAGGGCCTCGGTGTGGCGG 0: 1
1: 0
2: 2
3: 33
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027188581 Original CRISPR GGGCAAGGGCCTCGGTGTGG CGG Intronic
900117472 1:1034740-1034762 GTGCAGGGGCCTCGGGGTTGGGG - Intronic
900137883 1:1126117-1126139 GGGCAGGGGCCGCGGGGTGGGGG + Intergenic
900146490 1:1161041-1161063 GGGCAAAGGGCCCGGTCTGGGGG - Intergenic
900203267 1:1420602-1420624 GGGCAAGGGCGTCGGCGCGGGGG + Intronic
900309595 1:2027281-2027303 GGGCCAGGGCCTGGGTGTGAAGG + Intronic
900314791 1:2051257-2051279 AGGCAAGGGCCTCCGGGGGGCGG - Intronic
900329577 1:2127396-2127418 GGGCAGGGGCGGCGGTGGGGGGG - Intronic
900474489 1:2869788-2869810 GTGCAAGGGCCTTGGGGCGGGGG - Intergenic
900955061 1:5881570-5881592 GGGCAAAGGCCCCGATGTGGTGG + Intronic
901161077 1:7177133-7177155 TGGGAAGAGCCTCGGTGTGTGGG - Intronic
901161226 1:7177805-7177827 TGGCAAGGGGCTCAGTGTGTGGG - Intronic
901185309 1:7369048-7369070 TGGCCAGGTCCTGGGTGTGGAGG + Intronic
901377624 1:8850776-8850798 GGGCAAAGGGCTGGGTGCGGTGG + Intergenic
902375340 1:16027669-16027691 AGGCAAGAGCCTGGTTGTGGGGG + Intronic
902636062 1:17735836-17735858 GGGAAAAGGCCTCGGAGTAGTGG + Intergenic
902774593 1:18666605-18666627 GGGCAAAGGCTTTGGGGTGGGGG + Intronic
903540460 1:24093518-24093540 GAGCTGGGGCCTCGGTGAGGCGG + Intronic
905590269 1:39157255-39157277 TGGAAAGGGGCTGGGTGTGGTGG - Intronic
907128591 1:52074647-52074669 GGGTATGGGGCTGGGTGTGGTGG - Intronic
907336023 1:53700167-53700189 GCGCAAGGCCCTCGGCCTGGAGG + Intronic
907394332 1:54178794-54178816 GGGCAGGGGCCTGGCTGTAGAGG - Intronic
908208424 1:61874482-61874504 GCCCAAGGGGCTGGGTGTGGTGG - Intronic
908383502 1:63618730-63618752 GGCCAAGGGTCTGGATGTGGAGG + Intronic
909276715 1:73696325-73696347 TGGCAAAGGGCTGGGTGTGGTGG + Intergenic
909541134 1:76792762-76792784 GGGCAAGGGCCAGGCTGTGCAGG - Intergenic
913203833 1:116517474-116517496 CAGCAAGGGCCTAGGTGAGGTGG - Intronic
914572521 1:148932256-148932278 GGGCCAGGGCCTCAGTGTATTGG - Exonic
914600320 1:149198006-149198028 GGGCCAGGGCCTCAGTGTATTGG + Intergenic
915490861 1:156249417-156249439 AGGCTAGGGGCTCGGGGTGGAGG - Exonic
915593569 1:156884023-156884045 GGGCAAGGGCCACAGCGAGGTGG - Intergenic
915956895 1:160228214-160228236 TGTCAAGGGGCTTGGTGTGGTGG - Intronic
916445032 1:164864257-164864279 GGGCTAGGGCCTGGGAGAGGAGG - Intronic
919794673 1:201314163-201314185 GGGACATGGCCTGGGTGTGGTGG + Intronic
919835549 1:201570667-201570689 GGGCCAGGGCCAGGGTATGGGGG + Intergenic
920762846 1:208802345-208802367 AGGCATGGGGCTGGGTGTGGTGG - Intergenic
921225545 1:213015623-213015645 GGGCTACGGCCACTGTGTGGTGG - Exonic
922171503 1:223159501-223159523 GTGGAAGGGCCTAGGTGTAGTGG - Intergenic
923539752 1:234879579-234879601 AGGCAAGGGCCTCGGAGGAGTGG - Intergenic
924060708 1:240171021-240171043 GGGCTGGGGCGTCAGTGTGGTGG + Intronic
924519530 1:244794231-244794253 GGGGAAGGGGTTGGGTGTGGAGG - Intergenic
1063016546 10:2083755-2083777 GCGCAGGTGCCTGGGTGTGGAGG + Intergenic
1063503889 10:6579688-6579710 GGTCAAGGGCCTGGGGGAGGGGG - Intronic
1067256529 10:44647604-44647626 GGGCAAGAGCCTGGGTGAGGGGG - Intergenic
1069636953 10:69930667-69930689 GGGCCAGGGCTTAGGGGTGGAGG + Intronic
1069897131 10:71686893-71686915 GAGGAAGGGCCGCGGTGTGAAGG + Intronic
1070223927 10:74480564-74480586 AGGCTAGGGACTGGGTGTGGTGG - Intronic
1071274172 10:84037774-84037796 AGGCAAGGGAGTAGGTGTGGGGG + Intergenic
1071278420 10:84077328-84077350 GGTCCAGGGGCTGGGTGTGGTGG + Intergenic
1072663777 10:97379707-97379729 GGTCAAGAGCCGCCGTGTGGGGG + Exonic
1073499346 10:103921882-103921904 AAGCAAGGGCCACCGTGTGGAGG + Intergenic
1074533416 10:114312026-114312048 GGGGAAGGGTCTCTCTGTGGAGG + Intronic
1074813263 10:117126059-117126081 GGTCAAGGGCGTGGGTCTGGAGG + Intronic
1077095058 11:795726-795748 GGGCAAGGGGCTGGCTGTGGGGG - Intronic
1077102378 11:827906-827928 GGGGAAGGGCCTCAGTGTTGTGG + Intronic
1077219080 11:1407452-1407474 GAACAAGGGCCTCGGAGGGGAGG - Intronic
1077309004 11:1880297-1880319 GGTCAAGGGCCTGGGCTTGGGGG + Intronic
1077322007 11:1946888-1946910 GGGCAGGGGCACGGGTGTGGGGG + Intergenic
1078019067 11:7640375-7640397 GGGCAAGGGTGTCGGTCTGCAGG + Intronic
1078317557 11:10305585-10305607 GGGCAGGGGCCCCGGCGAGGCGG - Exonic
1079779688 11:24585038-24585060 GGGATAGGGCCTGGGTGTGGAGG + Intronic
1080425647 11:32151591-32151613 GTGCAAGGGCCTGGGTGAAGGGG + Intergenic
1081774779 11:45669750-45669772 GCCCAAGGGCCTCTGTGTTGGGG - Intergenic
1081909895 11:46694155-46694177 GGGCAATGGCCTCTGAGTGGTGG - Intronic
1083398205 11:62405768-62405790 GGGCCCGGGCCTGGGTGAGGGGG - Intronic
1083443894 11:62694490-62694512 GGGTAGGGGGCTGGGTGTGGTGG - Intronic
1083487871 11:62994967-62994989 GGGCATGGTCCAGGGTGTGGTGG + Intronic
1083572585 11:63768438-63768460 GGGCGGGGGCCCCGGCGTGGGGG - Intronic
1083668190 11:64286351-64286373 GGGCAAGGGTCTCTCTGTTGAGG + Intronic
1083738773 11:64696740-64696762 GGGCAAGGGCGTCCCTGGGGAGG - Intronic
1083935382 11:65867244-65867266 GGGCAGGAGCCTGGGTGGGGAGG - Intronic
1084078117 11:66798310-66798332 GGTGAAGGGGCTGGGTGTGGTGG + Intronic
1084182514 11:67454039-67454061 GGGAGAGGGCCGCGGTGGGGTGG - Intronic
1084594509 11:70108987-70109009 GGGCAAGGGACCCACTGTGGGGG - Intronic
1085472951 11:76769651-76769673 GGGGAGGGGCCTCGGGGTGCAGG - Intergenic
1085626552 11:78078376-78078398 GGGCAAGGACCTCTGAATGGAGG - Intronic
1086496145 11:87406285-87406307 TGACAAGGGCATCTGTGTGGAGG + Intergenic
1089305271 11:117522482-117522504 GGGCTAGGGGCTCTGTATGGGGG + Intronic
1089743508 11:120601116-120601138 GGTCCAGGGGCTGGGTGTGGTGG + Intronic
1090180066 11:124689497-124689519 GGGCAAAGGGCTGGGCGTGGTGG + Intronic
1090666238 11:128916712-128916734 AGGCCAGGGGCTCGGTGTGAGGG + Exonic
1202805023 11_KI270721v1_random:2201-2223 GGGCAGGGGCACGGGTGTGGGGG + Intergenic
1091554572 12:1562954-1562976 GGGCAGGGGACTAGGTGTGTGGG - Intronic
1091569356 12:1670962-1670984 GGGCAAGGGCCTGGTGGTGATGG - Intergenic
1092218921 12:6700165-6700187 GGGCAGGAGCCTCGGGGTGCGGG + Exonic
1093005136 12:14043399-14043421 GGTCAAGGGCCTCTGTGCTGGGG - Intergenic
1093090921 12:14919409-14919431 GGGCTATGGCCTCCGTGTTGTGG - Intronic
1093568966 12:20643866-20643888 GGGCCTGGGCCTTGGGGTGGGGG + Intronic
1095402357 12:41829604-41829626 TGGCAAGGGGCTGGATGTGGTGG + Intergenic
1097669803 12:62521903-62521925 GGGCTAGTGGCTGGGTGTGGTGG + Intronic
1100555209 12:95686469-95686491 GGGCAAGGGGCTGGGCGTGGTGG + Intronic
1101163181 12:102000185-102000207 GGGCAAAGGGCCAGGTGTGGTGG - Intronic
1103580750 12:121913364-121913386 GAGCAAAGGGCTGGGTGTGGTGG - Intronic
1103717503 12:122953807-122953829 GGGTAAGTGGCTGGGTGTGGTGG - Intronic
1103784822 12:123424616-123424638 TGGGAAGGGGCTGGGTGTGGTGG - Intronic
1103815169 12:123649253-123649275 GGGATGGGGCCTGGGTGTGGTGG - Intronic
1104280433 12:127371844-127371866 GGACAGGAGCCTCGATGTGGGGG - Intergenic
1104686584 12:130788818-130788840 GCGCACTGGCCACGGTGTGGGGG + Intergenic
1104841775 12:131829088-131829110 GGGCAGGGGCTACGGAGTGGGGG + Intronic
1105576505 13:21658141-21658163 AGGCAAGGACCTCGCTGTTGTGG - Intergenic
1107015502 13:35705477-35705499 GGGCCAGGACCTAGGTGGGGCGG + Intergenic
1107946547 13:45421874-45421896 GGGCAAGTGCATGGGTGAGGAGG - Intergenic
1108699635 13:52932966-52932988 GGGGAGGGGCCTGGGTTTGGAGG - Intergenic
1110338000 13:74354409-74354431 GGGCATGGGGCTGGGTGCGGTGG + Intergenic
1113373944 13:109746465-109746487 GTGCAAAGGCCCCGGGGTGGAGG - Intergenic
1113758958 13:112834164-112834186 ACTCAAGGGCCTTGGTGTGGGGG + Intronic
1115998031 14:39213768-39213790 GGGCATGGGGCTGGGTGCGGTGG + Intergenic
1118279425 14:64414974-64414996 GGGCCAGGGGCTGGGTGCGGTGG - Intronic
1118447764 14:65867437-65867459 GGGCAAGAGCCACAGTGTTGTGG - Intergenic
1118785654 14:69043669-69043691 AGACGAGGGCCTCGGTGGGGTGG - Intergenic
1122424650 14:101598868-101598890 GGGCAGGGGCCTGGGGCTGGAGG - Intergenic
1122550067 14:102544784-102544806 GGGCGACGGCCTGGGCGTGGCGG + Intergenic
1122968668 14:105143699-105143721 TGGCCAGGGCCTCAGTGTTGGGG - Intronic
1124052857 15:26215157-26215179 GGGCAACGGCTTCGATGGGGAGG + Intergenic
1124744703 15:32329558-32329580 GGGCACTGGGCTGGGTGTGGTGG - Intergenic
1125366926 15:38927290-38927312 GGCAAAGGGGCTGGGTGTGGTGG - Intergenic
1125675406 15:41499699-41499721 AGGCAAGTGCCTCTGTGGGGAGG + Intronic
1126487930 15:49203336-49203358 GGCAAATGGTCTCGGTGTGGTGG - Intronic
1126816182 15:52457152-52457174 GGCAAAGGGGCTTGGTGTGGTGG + Intronic
1127765416 15:62181459-62181481 GGGCAAAAGCCTCGGTGTGGTGG + Intergenic
1128079020 15:64845298-64845320 AGGAAAGGGCCTGGGTGAGGAGG + Intronic
1128884265 15:71272113-71272135 GGCAAAGGGGCTGGGTGTGGTGG + Intronic
1129070470 15:72946357-72946379 GGGCAAAGGCTTCGGTGGGCAGG - Intergenic
1129342810 15:74897268-74897290 TGGCAAGGGTCACGATGTGGAGG + Intronic
1130379898 15:83362634-83362656 GGGCAGGGGCCTCGAGGAGGAGG - Intergenic
1132410801 15:101577116-101577138 TGGCAAGGGCCATGGGGTGGGGG - Intergenic
1132500659 16:283313-283335 GGGCCAGGCCCAGGGTGTGGCGG - Exonic
1132709102 16:1258689-1258711 GGGGAAGGGGCTCAGGGTGGGGG - Exonic
1132801638 16:1757615-1757637 GAGCAAGGGCCCCACTGTGGAGG - Intronic
1133044081 16:3076521-3076543 GGGGAAGGAGCTGGGTGTGGTGG - Intronic
1133201805 16:4208389-4208411 GGGCCAGGGTCGCGGTGCGGGGG - Intronic
1133419468 16:5633584-5633606 GGGTAAAGGGCTGGGTGTGGTGG + Intergenic
1135325858 16:21525559-21525581 GTGCAGGAGCCTGGGTGTGGGGG + Intergenic
1136037447 16:27550560-27550582 GGGAAAGGGAATTGGTGTGGGGG + Intronic
1136111084 16:28063831-28063853 GGGCGGGGGCCTGGGAGTGGAGG + Intergenic
1136460629 16:30407968-30407990 GGGCCAGGGCCACGGTGGGCGGG + Intronic
1137037010 16:35576157-35576179 GGGCAGGGGCACGGGTGTGGGGG + Intergenic
1137617673 16:49856857-49856879 GGGCCAGGGGCTCGGAGAGGGGG + Intronic
1137708347 16:50549769-50549791 GGGAAAGGTCCTAGGTGGGGAGG + Intronic
1139505943 16:67398171-67398193 GGGAGGGGGCCTGGGTGTGGGGG - Intronic
1139733011 16:68963402-68963424 GGGCAAGGGGCTGGGCATGGTGG - Intronic
1139937141 16:70579692-70579714 GAGCCAGGGCCTGGGTTTGGGGG + Intergenic
1139968364 16:70758248-70758270 GGGCCAGGGTCTGGGTGAGGGGG + Intronic
1140615448 16:76657476-76657498 GGACAAAGGCCTGGATGTGGAGG - Intergenic
1140772406 16:78217008-78217030 GGGAGAGGGGCTGGGTGTGGTGG - Intronic
1141128751 16:81420108-81420130 GGGCAGGGGGCTGGGCGTGGTGG + Intergenic
1142068517 16:88076352-88076374 GGGCCGGGGCCTGGGTGTGCCGG + Intronic
1142267335 16:89070692-89070714 GGGCAAGGACGGCGGTGGGGGGG - Intergenic
1143002081 17:3800813-3800835 GGGAGAGGGCCTCGGTGGCGGGG + Intronic
1143389706 17:6553055-6553077 TGGCCAGGGGCTCGGTGCGGTGG - Intronic
1143697326 17:8630339-8630361 GGGTCAGGGCCTGGGTGTGCAGG - Intronic
1144800414 17:17922292-17922314 GGGCCAGGGCCTCGGTGAAGGGG + Intronic
1145280687 17:21464775-21464797 GAGCAAGGGCCGGGCTGTGGAGG - Intergenic
1145999303 17:29121822-29121844 GGGCAGGGGGCTGGGTGTGGGGG - Intronic
1146791930 17:35755885-35755907 GGGCAGGGGGCCAGGTGTGGCGG - Intronic
1147168381 17:38605046-38605068 GGGCTAGGGCCTCGAGGTGCGGG + Intronic
1147320033 17:39640515-39640537 GGGCAAGGGACAAGGGGTGGGGG - Intronic
1147338238 17:39739533-39739555 GGCCAGGGGCCTGGATGTGGCGG - Intronic
1148097821 17:45065997-45066019 GGGCAGGAGGCTGGGTGTGGTGG - Intronic
1148782562 17:50129993-50130015 GGGAAGGGGCGTCGGGGTGGGGG + Intergenic
1149607426 17:57934993-57935015 GGGGAACGGGCTGGGTGTGGTGG - Intronic
1150388827 17:64779641-64779663 GTCCAAGGGCCTTGGTGTGGGGG + Intergenic
1150790625 17:68198283-68198305 GTCCAAGGGCCTCGGTGTGAGGG - Intergenic
1152066543 17:78115509-78115531 GGGGAGGGGCCTCGGGGAGGAGG + Intronic
1152123864 17:78434881-78434903 GGGCCAGGCACTCTGTGTGGGGG + Intronic
1152360840 17:79832388-79832410 GGCCAAGGCCCTTGGTGTCGCGG - Intergenic
1152365036 17:79850653-79850675 GGAAAAGGGGCTGGGTGTGGTGG - Intergenic
1152577559 17:81149506-81149528 GGGCTAGTGCCTTGGGGTGGAGG - Intronic
1152597378 17:81244409-81244431 GGACCAGGGCCTGGGTCTGGGGG - Intergenic
1152631901 17:81414219-81414241 GGGCAGGGGCAACGGTGTGGGGG + Intronic
1152908502 17:82983737-82983759 GGGCAGGGGCCCCGGGGCGGAGG + Intronic
1152997015 18:416940-416962 GGGCAAGGGCATGGATGTGTGGG + Intronic
1153219068 18:2846840-2846862 CGGCAGGGGGCTCGGGGTGGAGG - Intergenic
1156527377 18:37779337-37779359 GGGCTGGGGACTGGGTGTGGGGG - Intergenic
1160822089 19:1063473-1063495 GGGGCAGGGCCACAGTGTGGCGG - Intronic
1160856317 19:1219425-1219447 GGGCAGGGGCCAGGGTGGGGCGG + Intronic
1161079772 19:2304994-2305016 GGGCATGAGGCTGGGTGTGGTGG - Intronic
1161092151 19:2366568-2366590 GGGCCAGGGGCTGGGTGCGGTGG + Intergenic
1161237488 19:3205110-3205132 GAGGAAGGGCCGGGGTGTGGTGG - Intronic
1161576739 19:5058559-5058581 GGGCCAGGGCCTGGGTGTGGTGG + Intronic
1161816298 19:6501994-6502016 GGGGAAGGGTCGCGGGGTGGGGG - Intronic
1162300436 19:9841973-9841995 GGGCATGGGTCTGGGTGTGGTGG + Intronic
1162567390 19:11451786-11451808 GGGCCTAGGCCTCGGTGGGGGGG + Exonic
1162729800 19:12711503-12711525 GGGCATGGGCGTGGGTGTCGCGG - Intronic
1162967208 19:14161574-14161596 GGGCGTGGGCCTGGCTGTGGTGG + Exonic
1163228130 19:15979360-15979382 GGCCAAGGGCCTCTGTCTTGGGG + Intergenic
1163455296 19:17403047-17403069 GGGCATGGGGTGCGGTGTGGGGG - Exonic
1163541263 19:17912170-17912192 GGGCATGGGGCTGGGTGTGGTGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1163693650 19:18751234-18751256 GGGAAATGGGCTGGGTGTGGTGG + Intronic
1164669472 19:30064429-30064451 GGGCAGGTGCCACGGGGTGGGGG - Intergenic
1164732578 19:30517418-30517440 GGGGAAGGGGCCCGGTGGGGAGG + Intronic
1164862992 19:31577887-31577909 GGGCACGGGCCTTGGTGAGCAGG + Intergenic
1165031683 19:33002283-33002305 GGGCCAGGGCCGCGTAGTGGTGG + Exonic
1165173026 19:33906659-33906681 GGGCGTGGGCCCCGGGGTGGAGG + Intergenic
1165720694 19:38077527-38077549 GAGGAAGGGCCTGGGAGTGGTGG + Intronic
1165828669 19:38719819-38719841 GGCCAAGGGGCTGGGTGTGGTGG + Intronic
1165999767 19:39871064-39871086 GGGTCAGGGCCAGGGTGTGGGGG + Intronic
1166513482 19:43427668-43427690 GGGCAAAGGGCTGGGTGCGGTGG - Intergenic
1167074797 19:47241432-47241454 GGGCAAGGGCAGGGGTGCGGGGG + Intergenic
1167906449 19:52664736-52664758 GGACAAGGGGCCTGGTGTGGGGG + Intronic
1168148502 19:54432528-54432550 GGGCAACTGCCTGGCTGTGGGGG - Intronic
1168676190 19:58279445-58279467 GGGCAAGGGTGTCGGCGGGGCGG - Exonic
925098753 2:1228455-1228477 GGGCAAGAGCCTGGGTGTGCAGG - Intronic
925285905 2:2715614-2715636 GGGAAAGGGGCGTGGTGTGGAGG - Intergenic
925413994 2:3656803-3656825 GGGCAGGGGTCAGGGTGTGGAGG + Intergenic
925730226 2:6914819-6914841 AGACAAGGGGCTGGGTGTGGTGG - Intergenic
925971792 2:9111271-9111293 GGGCCAGGCCCCCGGGGTGGGGG - Intergenic
927216950 2:20672731-20672753 AGGGCAGGGCCTTGGTGTGGGGG + Exonic
927518892 2:23687629-23687651 GTCCAAGGGCCTGGCTGTGGGGG + Intronic
928195736 2:29215342-29215364 GAGCAATGGCCTGGGTCTGGAGG + Intronic
929647393 2:43641078-43641100 GGGCAAAGGCCTGGACGTGGTGG - Intronic
932633886 2:73371100-73371122 GGGCAAGGGCATGGGTATGTTGG + Intergenic
933063414 2:77767414-77767436 AGGCAAGAGCCTCAATGTGGGGG - Intergenic
933253208 2:80051697-80051719 GAGCAATGGCCTCTGTGGGGGGG - Intronic
935508026 2:103931752-103931774 GGACAAGGGGTTCAGTGTGGAGG + Intergenic
936116996 2:109710609-109710631 GGGCCAGGGCCTTGGTGGTGGGG - Intergenic
936634783 2:114243606-114243628 GGGAAATGGGCTGGGTGTGGTGG + Intergenic
937127181 2:119482223-119482245 GGGCCAGGGCCTGGGTTAGGGGG + Intronic
937310799 2:120902190-120902212 GGGCAAGGGGTTGGGGGTGGGGG - Intronic
938678308 2:133661736-133661758 GGGAAAGGGCTTGGGTATGGGGG - Intergenic
943029138 2:182666328-182666350 AGACAAGGGGCTGGGTGTGGTGG + Intergenic
944531780 2:200674415-200674437 GGTCAAGGGCCTGGGTGGGGGGG + Intronic
946035413 2:216738319-216738341 GGGCAAATGCCTTGGGGTGGGGG + Intergenic
946339495 2:219058700-219058722 GGGCCAGGGCCTTGGTCTGAGGG + Intronic
947525760 2:230875816-230875838 TGGCCAGGGCCTGGGGGTGGGGG + Intronic
947750321 2:232528728-232528750 GGGCAGGGGCCTCTGTCTGAGGG - Intronic
947797550 2:232904514-232904536 TGGGAAGGGGCTGGGTGTGGTGG - Intronic
947835576 2:233172410-233172432 CGGCAGGGGCATCGGTGAGGAGG + Intronic
947933691 2:233985163-233985185 GGGCAAAGGCCCCGTGGTGGGGG - Intronic
948764538 2:240212651-240212673 GGGCATGGGGCTGGGTGGGGAGG - Intergenic
949044007 2:241862352-241862374 GGGGAAGGGCCTGGGTGTCCAGG - Intergenic
1169402736 20:5296898-5296920 GGGCATGAGGCTGGGTGTGGTGG + Intergenic
1171409148 20:24934546-24934568 GGGCATGGGCCTGGTTGTCGGGG - Intergenic
1171415868 20:24979980-24980002 GGGCAGGGGCCTGGGTTCGGGGG - Intronic
1173245065 20:41331173-41331195 TGGCCAGGGGCTCGGGGTGGTGG - Intergenic
1173520780 20:43698819-43698841 GGGGAGGGGGCTGGGTGTGGCGG - Intronic
1173562087 20:44013204-44013226 GGGCAAGGGCCTTGGAGTTAGGG + Intronic
1174363487 20:50042770-50042792 GTGCAATGGCCTCGGTGTTTGGG - Intergenic
1176125681 20:63473472-63473494 GAGCAAGGGCCATGGGGTGGGGG + Intergenic
1176241434 20:64077516-64077538 GGGGCAGGGCCCCGGTGAGGAGG + Intronic
1178978214 21:37238984-37239006 GAGCACGGGGCTCGGTGAGGGGG - Intronic
1179654186 21:42834944-42834966 GGACAAGGTCATAGGTGTGGAGG - Intergenic
1179717688 21:43298190-43298212 GTGCAAGGGCATTGGTGTGGAGG - Intergenic
1179990281 21:44944653-44944675 GGGAGAGGGCCTGGCTGTGGGGG + Intronic
1180050884 21:45330570-45330592 GGACCAGGGCCTCAGAGTGGAGG + Intergenic
1180050898 21:45330601-45330623 GGCCCAGGGCCTCAGGGTGGAGG + Intergenic
1180161257 21:45999566-45999588 GGGCAGGGCCCTGGGGGTGGGGG + Intronic
1181020578 22:20099920-20099942 GAGCAAGAGACTAGGTGTGGTGG - Intronic
1181816367 22:25439991-25440013 GGGCAAAGGGCCAGGTGTGGTGG - Intergenic
1183479034 22:38052820-38052842 TGGCAAGGGCCTCAGAGGGGAGG - Intergenic
1183744820 22:39686225-39686247 GGGCCAGGGCGGCGGCGTGGGGG - Exonic
1184988546 22:48152724-48152746 GGGCACGGGGCTTGGGGTGGGGG - Intergenic
1185258182 22:49848300-49848322 GGGCGAGGGCCTCGGGGAAGTGG - Intergenic
1185354804 22:50361812-50361834 GGACTAGGGCCTTGCTGTGGTGG + Intronic
1185409140 22:50673646-50673668 GGGGAAGGGCCTAGGGGAGGGGG - Intergenic
953602325 3:44379079-44379101 GAGCCTGGGCCTCGGTGGGGAGG + Intronic
954317900 3:49811248-49811270 GGGCAGAGGCATAGGTGTGGGGG - Intronic
954418365 3:50405347-50405369 GAGCAAGGGCCGTGGTGGGGAGG + Intronic
954539289 3:51383071-51383093 GGCCCAGGGCCTGGCTGTGGAGG - Exonic
959991729 3:112638739-112638761 GGTCCAGGGCCTCTGCGTGGTGG + Exonic
961129543 3:124453266-124453288 GGGCAAGAGCTTTGGTGTGAAGG - Intronic
961214157 3:125146866-125146888 GAGGAAGGGCCTCCCTGTGGTGG - Intronic
961558532 3:127713077-127713099 GGGCAAGGGCCACACTGTGAGGG + Intronic
961752236 3:129103475-129103497 GGACAAGGGCCTCGGTGCAGAGG - Intronic
962350441 3:134651970-134651992 GAGCAAAGGCCTCCATGTGGGGG - Intronic
964427425 3:156568421-156568443 CCGCTAGGGCCTCTGTGTGGGGG - Intergenic
965646792 3:170892137-170892159 TGGAAAGGGGCTGGGTGTGGTGG + Exonic
966385110 3:179388017-179388039 GGGCAAGGGGCTGGGCATGGAGG - Intronic
967038060 3:185662965-185662987 GGGAATGGGGCTGGGTGTGGTGG - Intronic
967782437 3:193455049-193455071 GGGCAAAGGGCCGGGTGTGGTGG + Intronic
968177836 3:196566793-196566815 GGGGAAGGGGCTTGGTGGGGTGG + Intronic
968277344 3:197450510-197450532 GGGCCAGGGCCCCTTTGTGGAGG + Intergenic
968563219 4:1295853-1295875 GGGCAAAGGCGCAGGTGTGGTGG - Intronic
968937669 4:3620927-3620949 GGGCAGGAGCCTGGGGGTGGGGG + Intergenic
969464732 4:7349507-7349529 GGGCAGGGGGCTGGGTGAGGTGG + Intronic
970867217 4:20772919-20772941 GGGAAAGGGGCCGGGTGTGGTGG - Intronic
970928751 4:21484137-21484159 GAGAAAGGGGCTGGGTGTGGTGG + Intronic
971607649 4:28679005-28679027 GGACAAGGCCCTAGCTGTGGGGG - Intergenic
972447242 4:39156728-39156750 GGGAAAGGGGCCAGGTGTGGTGG + Intergenic
972680677 4:41303985-41304007 GTGCTAGGGCCTCTGTGGGGAGG + Intergenic
974705880 4:65514867-65514889 GGTCAAGGGCCTAGGTGTTGTGG - Intronic
976937081 4:90649817-90649839 GGTCAAGGGGCTGGGTGTGGTGG + Intronic
977580417 4:98718559-98718581 GGGAAAGGGTCTGGGTGCGGTGG - Intergenic
977610191 4:99022650-99022672 AGGCAAGGTGCTCGCTGTGGTGG + Intronic
979378093 4:119973079-119973101 GGGCAAAGGGCCAGGTGTGGTGG + Intergenic
981811787 4:148783845-148783867 GGAGAAGGGGCTGGGTGTGGGGG - Intergenic
982380881 4:154745541-154745563 GGGCAAGTGACTGGGGGTGGGGG + Intronic
982797070 4:159659147-159659169 GGGCAAGGGGCTGGGTGAGGAGG - Intergenic
983912042 4:173250742-173250764 GGGTAAGGGCCACAGCGTGGGGG - Intronic
984699024 4:182806747-182806769 GGGCCCAGGCCTCGGTGCGGCGG - Intergenic
984852997 4:184169617-184169639 GGGCAGGGTCCTGGCTGTGGAGG + Intronic
985682478 5:1263854-1263876 GGGACAGGGCCATGGTGTGGGGG - Intronic
985909318 5:2866527-2866549 GAGCCAGGGGCTGGGTGTGGCGG - Intergenic
988321822 5:29708230-29708252 GATAAAGGGCCTGGGTGTGGTGG + Intergenic
991054571 5:62306767-62306789 GGGAAAGGGCCCGGGTGTCGAGG + Intronic
998182298 5:139954040-139954062 AGGCAAGGGGCAGGGTGTGGGGG + Intronic
1001134811 5:169093459-169093481 GGGCAGGGGCTTGGGGGTGGGGG + Intronic
1001652649 5:173327051-173327073 GGGCGAGGGTCTCGGGGTGGTGG + Intronic
1001734490 5:173987971-173987993 AGGAAAGGGGCTGGGTGTGGTGG + Intronic
1001793285 5:174480079-174480101 GGACCAGGGCCTGGATGTGGTGG - Intergenic
1003007579 6:2396087-2396109 GGGCAAAGGCATGGGTTTGGCGG + Intergenic
1004194122 6:13488373-13488395 GGGCATGGGCCTAGGGGCGGGGG - Intergenic
1004352285 6:14900788-14900810 GGGCAAAGGGCTGGGCGTGGTGG + Intergenic
1006451723 6:34109334-34109356 GGGCAGGGGCCTGGGTGGGTGGG - Intronic
1006909906 6:37557163-37557185 GGGCAAGGGCCTAGGTCAGAGGG - Intergenic
1010249891 6:73696351-73696373 GGGCCAGGGCTTCGGGGAGGTGG + Intronic
1017127790 6:151081749-151081771 GGGCAAGGGTCTAGTTGTGAGGG + Intronic
1019298418 7:290871-290893 GCGCCAGGGCCTCGGTGGCGGGG + Intergenic
1019593772 7:1848863-1848885 GGGCAAGGACCTTGGTGGTGGGG - Exonic
1019835325 7:3377705-3377727 GGGCAGGGGGCTGTGTGTGGGGG + Intronic
1020054719 7:5109559-5109581 GGGGAAGGGGCCAGGTGTGGTGG - Intergenic
1020406725 7:7843894-7843916 GTGCAGGGGCCAGGGTGTGGGGG - Intronic
1023069349 7:36413701-36413723 AGTCAAGGGGCTCGGCGTGGTGG + Intronic
1023837097 7:44074570-44074592 GGGATGGGGGCTCGGTGTGGTGG - Intronic
1024053757 7:45646516-45646538 GGGCAAGGGTCTCTGTGCAGTGG - Intronic
1026280523 7:68918204-68918226 GGGCAAGAGCCCTGGTGTAGCGG - Intergenic
1026863851 7:73810783-73810805 GGGGAAGGGGCTCAGGGTGGGGG + Intronic
1027188581 7:75985530-75985552 GGGCAAGGGCCTCGGTGTGGCGG + Intronic
1029551638 7:101239853-101239875 AGGCATGGCCCTGGGTGTGGCGG - Exonic
1030519936 7:110586445-110586467 GGGCATGGGCTTGGGTGAGGTGG - Intergenic
1032151307 7:129432610-129432632 GGGCGGGGGGCTGGGTGTGGGGG - Intergenic
1033016624 7:137678199-137678221 GGGCCAAGGCCTGTGTGTGGAGG - Intronic
1033318574 7:140318793-140318815 TAGCAAGGGCCTTGGTGAGGTGG + Intronic
1033658289 7:143387663-143387685 GGGACAGGGTCTCTGTGTGGGGG + Intronic
1034460146 7:151193570-151193592 GGCCAAGGGCCTAGGGCTGGGGG + Intronic
1035248459 7:157580899-157580921 GTGCAGGTGCCACGGTGTGGAGG - Intronic
1036941199 8:13054256-13054278 GCACAAGGGGCTGGGTGTGGTGG - Intergenic
1037827646 8:22168741-22168763 GGGCAGGGGCCTGGGTGGGTGGG - Intronic
1037887513 8:22602599-22602621 GGGCAGGGGGCTCAGGGTGGTGG - Exonic
1038975406 8:32690318-32690340 GGGTAAGGGACTTGCTGTGGGGG - Intronic
1039140386 8:34380949-34380971 GAGCCAGGGGCTGGGTGTGGTGG + Intergenic
1039470837 8:37812973-37812995 GGACAAGGGGCTGGGTGTGGTGG - Intronic
1041193315 8:55375075-55375097 GGGAAAGGACCTCAGTTTGGAGG + Intronic
1044953384 8:97455083-97455105 GAGCAAGGGCCTGGGTGGGGAGG + Intergenic
1047036518 8:120945064-120945086 AGGCAATGGGCTGGGTGTGGTGG - Intergenic
1047747171 8:127853929-127853951 GAGCAAGGGCCACGGGATGGGGG - Intergenic
1048461889 8:134627984-134628006 GCGCACGTGCCTCGGTGTGTTGG - Intronic
1049241440 8:141539357-141539379 GTGCAAGGGCCTCGGCGGTGGGG + Intergenic
1049357584 8:142196357-142196379 GGGCAAGGGCCTGGGAGGAGAGG + Intergenic
1049404362 8:142445133-142445155 GCTGAAGGGCCTCTGTGTGGGGG - Intergenic
1049710403 8:144060610-144060632 GGGGAAGGGCCGCGGAGGGGAGG + Intronic
1050091061 9:2016648-2016670 GGGGAAGGGCTGCGGTGGGGAGG + Intronic
1051613628 9:18985683-18985705 GGGCAGGGGAGTCGGAGTGGTGG - Intronic
1053278583 9:36801624-36801646 GGGCATGGACGTCGCTGTGGAGG + Intergenic
1054453487 9:65416764-65416786 GGGCAGGAGCCTGGGGGTGGGGG - Intergenic
1054982513 9:71223035-71223057 GGGCTAGGGGCTGGGGGTGGTGG + Intronic
1055507711 9:76964982-76965004 GGGGAAAGGCCTCTGTCTGGTGG + Intergenic
1057782603 9:98061932-98061954 GAACCAGGGCCTGGGTGTGGTGG + Intronic
1057865506 9:98677234-98677256 GGTCAAGAGCCTGGGTCTGGAGG - Intronic
1057905043 9:98976712-98976734 GGGACAGAGCCTGGGTGTGGGGG + Intronic
1060145379 9:121248331-121248353 AGACAAGGGCTTGGGTGTGGTGG - Intronic
1060230632 9:121822684-121822706 TGGGGAGGGCCACGGTGTGGGGG + Exonic
1060506025 9:124199050-124199072 GGGCCAGGGCCTGGGTGCGGTGG - Intergenic
1061449490 9:130660683-130660705 GGGCCCGGGCCTGGGTGCGGGGG - Intergenic
1062101429 9:134730602-134730624 GGCCCAGGGCCAGGGTGTGGTGG - Intronic
1062129185 9:134883501-134883523 GGGCAGGGGTCTCAGTGTGGGGG + Intronic
1062282730 9:135759226-135759248 GGGCAGAGGCCTGAGTGTGGTGG + Intronic
1062488028 9:136790965-136790987 GGGCCAGGGCCTTGGATTGGGGG - Intergenic
1062575628 9:137205921-137205943 TCGCTAGGGCCTCGGCGTGGGGG + Intronic
1185460434 X:330764-330786 GGGCAAGGGCCTGTGTGTTGGGG + Intergenic
1186056655 X:5656306-5656328 GTGAAAGGGGCTGGGTGTGGTGG + Intergenic
1187293030 X:17973582-17973604 GGGAAAGGACCTTGGTGTGGTGG - Intergenic
1187311313 X:18146138-18146160 GGAAAAGGGACACGGTGTGGTGG - Intergenic
1187393852 X:18903613-18903635 GGAGAAGGGCCTCGGGCTGGAGG + Intronic
1188248638 X:27864072-27864094 GGGCAGGGGCTTCGGGCTGGTGG + Intergenic
1189434395 X:40979017-40979039 CAGCAAGGGGCTGGGTGTGGTGG + Intergenic
1190916103 X:54812259-54812281 GGGAAAGGGCTGAGGTGTGGGGG + Intronic
1192034233 X:67545881-67545903 GTCCATGGGCCTGGGTGTGGAGG + Exonic
1192510762 X:71719246-71719268 GGGCCACGGCCTCGATTTGGGGG + Intergenic
1192515935 X:71762307-71762329 GGGCCACGGCCTCGATTTGGGGG - Intergenic
1196848138 X:119912998-119913020 GGGAAAGCGCCTGGGAGTGGTGG + Intronic
1200096906 X:153668823-153668845 GAGCAAGGGTCTCAGAGTGGAGG + Intergenic
1200151118 X:153951946-153951968 GGGCCAGGGCCTCAGTGGGGAGG + Exonic