ID: 1027188623

View in Genome Browser
Species Human (GRCh38)
Location 7:75985736-75985758
Sequence CTTGAAGGGCAGGCGGAACT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 129}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027188623_1027188630 -1 Left 1027188623 7:75985736-75985758 CCCAGTTCCGCCTGCCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1027188630 7:75985758-75985780 GGCCACCACGCCTGTCATCATGG 0: 1
1: 0
2: 1
3: 18
4: 269
1027188623_1027188637 15 Left 1027188623 7:75985736-75985758 CCCAGTTCCGCCTGCCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1027188637 7:75985774-75985796 ATCATGGTGGGCCCCGGCACCGG 0: 1
1: 0
2: 1
3: 7
4: 79
1027188623_1027188633 3 Left 1027188623 7:75985736-75985758 CCCAGTTCCGCCTGCCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1027188633 7:75985762-75985784 ACCACGCCTGTCATCATGGTGGG 0: 1
1: 0
2: 1
3: 8
4: 82
1027188623_1027188639 17 Left 1027188623 7:75985736-75985758 CCCAGTTCCGCCTGCCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1027188639 7:75985776-75985798 CATGGTGGGCCCCGGCACCGGGG 0: 1
1: 0
2: 2
3: 8
4: 143
1027188623_1027188638 16 Left 1027188623 7:75985736-75985758 CCCAGTTCCGCCTGCCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1027188638 7:75985775-75985797 TCATGGTGGGCCCCGGCACCGGG 0: 1
1: 0
2: 0
3: 11
4: 124
1027188623_1027188640 20 Left 1027188623 7:75985736-75985758 CCCAGTTCCGCCTGCCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1027188640 7:75985779-75985801 GGTGGGCCCCGGCACCGGGGTGG 0: 1
1: 0
2: 1
3: 25
4: 317
1027188623_1027188632 2 Left 1027188623 7:75985736-75985758 CCCAGTTCCGCCTGCCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1027188632 7:75985761-75985783 CACCACGCCTGTCATCATGGTGG 0: 1
1: 0
2: 0
3: 11
4: 149
1027188623_1027188636 9 Left 1027188623 7:75985736-75985758 CCCAGTTCCGCCTGCCCTTCAAG 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1027188636 7:75985768-75985790 CCTGTCATCATGGTGGGCCCCGG 0: 1
1: 1
2: 3
3: 26
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027188623 Original CRISPR CTTGAAGGGCAGGCGGAACT GGG (reversed) Exonic
900117752 1:1035729-1035751 CTTGCAGGGAAGGCTGAGCTGGG + Intronic
900488387 1:2934373-2934395 CTTGAAAGGCAGCCGGTCCTGGG + Intergenic
907266949 1:53267872-53267894 CTTGAGGGGCAGGTGTTACTAGG - Intronic
909657449 1:78046632-78046654 CTTGAACGGCCGGCGGAATCCGG - Intronic
911886328 1:103304711-103304733 CTTGCCGGGCAGGGGGAAGTTGG - Intergenic
911997839 1:104788969-104788991 CTTGAAGGTCAGGCATCACTGGG + Intergenic
915347689 1:155206285-155206307 CTTGGGGGGCAGGCGGAAGGTGG + Exonic
915643702 1:157251528-157251550 CTAGAAGTGCAGGAGGAAGTTGG - Intergenic
916166892 1:161972835-161972857 CTAGAGGGGCAGGGTGAACTAGG + Intergenic
918177186 1:182056889-182056911 GTTGAAGGTCAGGCCGCACTCGG + Exonic
920808595 1:209259277-209259299 CTTGAAGGACAGACAGAATTTGG + Intergenic
921200863 1:212804745-212804767 CTTGAAGGGCAGGGGCAAGAAGG + Intronic
922807419 1:228397588-228397610 CCTGCAGGGCAGGTGGAGCTGGG - Intronic
1065759104 10:28965174-28965196 CTTCCAGGGCAGGCACAACTGGG - Intergenic
1067452922 10:46393354-46393376 CTGGAAGGCCAGGCTCAACTGGG + Intergenic
1067584308 10:47466406-47466428 CTGGAAGGCCAGGCTCAACTGGG - Intronic
1072036103 10:91564244-91564266 CTAGAAGGCCAGGCGGCACAGGG + Intergenic
1072944680 10:99799059-99799081 CTAGAAGGGCAGAAGCAACTAGG + Intronic
1075131485 10:119743562-119743584 AATGAAGGGCAGGCAGAAGTGGG + Intronic
1075643788 10:124084484-124084506 CTTGATGGGCAGCAGGAGCTGGG - Intronic
1077506121 11:2930706-2930728 CCTGAAGGGCAGGTGGAGGTAGG - Intergenic
1083519405 11:63294321-63294343 CTTGGAGGGCAGGAGAAAATTGG - Intronic
1084859529 11:72009220-72009242 GTTGAAGGGCAGGAGGAAGGTGG + Intronic
1087193438 11:95280672-95280694 CTGGCAGGGCAGGCAGGACTGGG + Intergenic
1089133638 11:116232105-116232127 CTTGAAGGGCTGGGGGAAGGAGG - Intergenic
1090367002 11:126214991-126215013 CTTGAAGAGCAGGAAGTACTTGG + Intronic
1096234651 12:49917928-49917950 CTTGAAGTGCGGGCAGAACCGGG - Intergenic
1096786817 12:54021649-54021671 CTTGAAGGGCGGGAGGAAGGTGG - Intronic
1098897985 12:76084529-76084551 CTGGAAGGGAAGGGGGAACGTGG - Intronic
1099322042 12:81162615-81162637 CTTGAAGGGGAGGCTTCACTGGG + Intronic
1100444692 12:94650128-94650150 CGTGAGGGGCAGGCGGACCTGGG + Intronic
1102431964 12:112890746-112890768 TATGAAGGGCAGGCGAAGCTTGG - Intronic
1105562552 13:21507974-21507996 GCTGAAGGGCAGGAGGCACTTGG + Intronic
1113537618 13:111080816-111080838 CTTGCAGGGCAGGAGGAACAAGG - Intergenic
1113908910 13:113832651-113832673 CTTGAAGCGCAGTCGGATCACGG + Exonic
1114657819 14:24326493-24326515 CTTCAAGGGCAGGTGGGATTTGG - Intronic
1115492306 14:33969234-33969256 CTTCAAGGGCTGGACGAACTAGG + Intronic
1116537133 14:46046594-46046616 CTTGCAGGTCAGGAGGAAGTGGG - Intergenic
1116683587 14:48009791-48009813 CTTGAAGAGAAGACAGAACTGGG + Intergenic
1119640443 14:76310540-76310562 CATGAAGGGGAGGAGGAACTGGG - Intergenic
1119778971 14:77265739-77265761 GATGAAGGGCTGGGGGAACTCGG + Exonic
1120583523 14:86283272-86283294 CTTGAAAGGCAGGCGGATGGTGG + Intergenic
1121283699 14:92718175-92718197 CTCGAAGGTGAGGAGGAACTCGG + Intronic
1121587655 14:95074005-95074027 CTTTGAGGGCAGGCGGGACTTGG + Intergenic
1123459839 15:20459680-20459702 CTTGCAGGGAAGGAGGATCTTGG - Intergenic
1123658223 15:22540740-22540762 CTTGCAGGGAAGGAGGATCTTGG + Intergenic
1124312088 15:28635232-28635254 CTTGCAGGGAAGGAGGATCTTGG + Intergenic
1124712787 15:32029771-32029793 CTGGAAGGACAGCCAGAACTTGG - Intergenic
1126553993 15:49965961-49965983 CATGAAGGGCAAGCAGAAATAGG + Intronic
1128175715 15:65553979-65554001 TATGAAGGACAGGTGGAACTAGG - Intronic
1132788471 16:1671353-1671375 CTTGAGGGGAAGGCGAAACGTGG + Intronic
1134314881 16:13109342-13109364 CTTCAAGGGTAGGCCCAACTTGG + Intronic
1134852134 16:17488452-17488474 GTTGAAGGGCAGGAGGAAAGTGG + Intergenic
1136114643 16:28087175-28087197 CTGGAAGGGCAGCAGGAGCTGGG + Intergenic
1136290420 16:29268281-29268303 CCTGAAGGGCAGGGGCAGCTGGG - Intergenic
1138245234 16:55462510-55462532 ATTCAAGGGCAGGAGGCACTTGG + Intronic
1140827058 16:78716446-78716468 CTTGAAGGGCAGGCAGCATTTGG - Intronic
1140881732 16:79204664-79204686 ATTGAAGGGCAGGGTGACCTTGG - Intronic
1142096302 16:88241802-88241824 CCTGAAGGGCAGGGGCAGCTGGG - Intergenic
1142560909 17:808263-808285 CTTCAAGGGCTGGGGGAACAGGG - Intronic
1142977756 17:3655860-3655882 CTTGAGGGGCAGGGAGATCTTGG + Intronic
1144731591 17:17529242-17529264 CTGGCAGGACAGGTGGAACTGGG - Intronic
1146797540 17:35793664-35793686 CTCGAAGGGCAAGCTGAATTTGG - Intronic
1147588709 17:41667478-41667500 CTTACAGGGCAGGCGGGGCTGGG + Intergenic
1147790512 17:43011774-43011796 TGTGAAGGGCAGCCGGAATTTGG - Intronic
1148142115 17:45336456-45336478 GCTGAAGGGCAGGCTGACCTAGG + Intergenic
1148214639 17:45827758-45827780 CTTGGTGGCCGGGCGGAACTGGG + Intronic
1148348649 17:46922587-46922609 CTTTGAGGGCAGGAGGAACCCGG + Intergenic
1150319323 17:64198443-64198465 CATGAAGGGCGGGGGGAAGTTGG + Intronic
1150494903 17:65599954-65599976 CCTGAAGGGAAGGAGGAAGTTGG + Intronic
1151966752 17:77435506-77435528 GGTGTAGGGCAGGCGGCACTGGG - Intronic
1155239592 18:23852906-23852928 CTTGAAGGACAGGCATAATTTGG - Intronic
1157323743 18:46654515-46654537 CTTTGAGGGCAGGCTGAACGTGG - Intronic
1164601891 19:29567908-29567930 CCTGAAGGGGAGGCTGAACCCGG + Intergenic
1165100168 19:33434541-33434563 CTGGCAGGGCAGGCGGGAATGGG + Intronic
927218337 2:20682985-20683007 CTAGAAGGGCAGGTAGAACTTGG - Intergenic
928228881 2:29478775-29478797 TTTGAAGGGCAGGCAGGATTTGG + Intronic
931124317 2:59256976-59256998 CTTGAAGGGAAGGGAGAACTAGG + Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
935662064 2:105475408-105475430 CTTGAATGACAGGTGGAGCTAGG + Intergenic
939608861 2:144285871-144285893 CTAGAAGGGCACGAGGGACTGGG - Intronic
939688556 2:145229006-145229028 TTGGAAGTGTAGGCGGAACTTGG + Intergenic
939886237 2:147685012-147685034 CTTGAAGTGCAGGTAGAATTTGG - Intergenic
945208112 2:207353698-207353720 CTTGAAGGGCAGAAAGAATTGGG - Intergenic
946422561 2:219572702-219572724 TTTGCAGGCCAGGCGGACCTGGG + Intronic
948621626 2:239238904-239238926 CTTGAAGGGTAGGTGGGACGCGG - Intronic
948862364 2:240758774-240758796 CTAGAGGGGCTGGCGGCACTGGG + Intronic
1169342808 20:4809455-4809477 GCTGAAGGGCAGGCCGAAGTGGG - Intronic
1169674086 20:8133999-8134021 CTGGAAGCGCAAACGGAACTTGG + Intronic
1172649141 20:36490756-36490778 CTTGGAGGCCAGGCTGAACTTGG - Intronic
1174082898 20:47983458-47983480 CTGGAAGGGCAGGAGGGACTGGG + Intergenic
1174133058 20:48359525-48359547 GTGGAAGGGCAGGAGGGACTGGG - Intergenic
1180959494 22:19756170-19756192 TGTGCAGGGGAGGCGGAACTGGG + Intergenic
1182619534 22:31611327-31611349 CTTGCCAGGCAGGCAGAACTTGG - Intronic
950846533 3:16021083-16021105 CTTGAGGGATAGGAGGAACTTGG + Intergenic
953913599 3:46904859-46904881 CTGGAAGGGCAGGCAGGGCTGGG - Intergenic
954450208 3:50567576-50567598 CTTGCAGGGAGGGCGGATCTCGG - Exonic
957262770 3:77922238-77922260 CTTGAAGGTCAGGCTTCACTGGG + Intergenic
960699581 3:120427165-120427187 CTTGAAGGACAGGGAGAATTTGG - Intronic
960915459 3:122690008-122690030 CTTGAAGGGTATGTGGAATTGGG - Intronic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
970149869 4:13078240-13078262 CCTGAAGGGCAGGTGGAAAAAGG - Intergenic
970328083 4:14949145-14949167 CTTGAAGGGCTGGAAGAAGTAGG - Intergenic
971074416 4:23131219-23131241 TTTGAAGGGCAGACGTAAATTGG - Intergenic
972342906 4:38167932-38167954 CAGGAAGGGTAGGGGGAACTGGG - Intergenic
973579622 4:52330143-52330165 CTTGCAGGCCAGGAGGAAATTGG - Intergenic
982071170 4:151695673-151695695 CTTGAAGGACAGGAGGCACCAGG + Intronic
985699073 5:1359462-1359484 CTTGAAGGGAAGGCGAGGCTGGG - Intergenic
986371116 5:7081207-7081229 CTTTATTGGCAGGCAGAACTAGG - Intergenic
996663925 5:126035810-126035832 GATGAAGGGCAAGAGGAACTAGG - Intergenic
997581267 5:135018878-135018900 CTTAAAAGACAGGCAGAACTGGG - Intergenic
998430799 5:142068240-142068262 CTTAAAGGGCAGGAGGGATTTGG - Intergenic
1008136099 6:47778942-47778964 CTTGAAGGTCAAGTGGAATTTGG + Intergenic
1010974226 6:82294761-82294783 CTTGAAAGTCAGACTGAACTGGG + Intergenic
1011311714 6:85986962-85986984 CTTGCAGGGCAGGAGAAAGTGGG - Intergenic
1012769128 6:103405750-103405772 CTTGAACTGCAAGGGGAACTGGG + Intergenic
1014268666 6:119311787-119311809 CTTGAAGGGCAGTAGCAGCTCGG + Intronic
1017103325 6:150866485-150866507 CGGGAAGGGCAAGCGGAGCTCGG + Intronic
1017433052 6:154390340-154390362 CATAAAGGGCAGGAGGAACTAGG - Exonic
1017536722 6:155354775-155354797 CTTGTAGGCCAGGAGGAAGTGGG + Intergenic
1018912297 6:168108850-168108872 CGTGATGGGAAGGCGGAGCTTGG - Intergenic
1019429143 7:990773-990795 CTTGAAGGGCAGAAAGAACGGGG + Intergenic
1020079726 7:5281065-5281087 CTTGAAGGGCAGACTGCATTGGG - Intronic
1024097604 7:45996403-45996425 CATGAAGGGCAGAAGGAAGTGGG + Intergenic
1024131028 7:46353518-46353540 CTTGAATGGTGGGCGTAACTGGG + Intergenic
1024872735 7:53984730-53984752 CTTGAAGGACAGGCGGATGCAGG - Intergenic
1025199180 7:56951138-56951160 CTTGAAGGGCAGACTGCATTGGG + Intergenic
1025672767 7:63625795-63625817 CTTGAAGGGCAGACTGCATTGGG - Intergenic
1026931284 7:74224256-74224278 CTGGAAGGGCAGGCTGAAAGTGG + Intronic
1027188623 7:75985736-75985758 CTTGAAGGGCAGGCGGAACTGGG - Exonic
1032116144 7:129118876-129118898 CTTGAAGGGCAGAGGGAAGTGGG - Intergenic
1032584756 7:133135971-133135993 CTGGAAGGGCTGGAGGCACTAGG + Intergenic
1036211397 8:6843972-6843994 ATAGAAGGGCAGGAGGCACTGGG + Intergenic
1044974532 8:97650583-97650605 CTTGAAGGACAGGTGGAAATTGG - Intronic
1045062897 8:98424255-98424277 CTTGAATGGCAGAGTGAACTTGG - Intronic
1047821341 8:128524682-128524704 CTTGACGGGGAGGGGGAATTGGG + Intergenic
1048008342 8:130437278-130437300 CTTGAAGGGGATTGGGAACTGGG - Intronic
1052795808 9:32922286-32922308 GCTGAAGGGCAGGAGGAAATGGG + Intergenic
1060585528 9:124782977-124782999 CTTGAAGGACAGGCAGAGTTAGG + Intronic
1062020908 9:134319053-134319075 CTGGCAGGGCAGGTGGAACCTGG + Intronic
1185528044 X:794653-794675 ACAGAAGGGCAGGAGGAACTGGG + Intergenic
1193361772 X:80587178-80587200 CATGAAGGGCAAGCAGAAGTAGG - Intergenic
1198216064 X:134555932-134555954 CTTGAAGGGAAGGTGGAATTTGG + Intergenic