ID: 1027196613

View in Genome Browser
Species Human (GRCh38)
Location 7:76034932-76034954
Sequence ACTGAGCTGCAGACTCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027196609_1027196613 -6 Left 1027196609 7:76034915-76034937 CCCACCTTGACCTGTCTACTGAG 0: 1
1: 0
2: 0
3: 28
4: 301
Right 1027196613 7:76034932-76034954 ACTGAGCTGCAGACTCTAGAAGG No data
1027196607_1027196613 6 Left 1027196607 7:76034903-76034925 CCCAAATTTTATCCCACCTTGAC 0: 1
1: 0
2: 1
3: 16
4: 152
Right 1027196613 7:76034932-76034954 ACTGAGCTGCAGACTCTAGAAGG No data
1027196605_1027196613 26 Left 1027196605 7:76034883-76034905 CCACACACATACCAATGATTCCC 0: 1
1: 1
2: 1
3: 9
4: 152
Right 1027196613 7:76034932-76034954 ACTGAGCTGCAGACTCTAGAAGG No data
1027196611_1027196613 -10 Left 1027196611 7:76034919-76034941 CCTTGACCTGTCTACTGAGCTGC 0: 1
1: 0
2: 2
3: 19
4: 204
Right 1027196613 7:76034932-76034954 ACTGAGCTGCAGACTCTAGAAGG No data
1027196608_1027196613 5 Left 1027196608 7:76034904-76034926 CCAAATTTTATCCCACCTTGACC 0: 1
1: 0
2: 0
3: 12
4: 164
Right 1027196613 7:76034932-76034954 ACTGAGCTGCAGACTCTAGAAGG No data
1027196610_1027196613 -7 Left 1027196610 7:76034916-76034938 CCACCTTGACCTGTCTACTGAGC 0: 1
1: 0
2: 1
3: 20
4: 285
Right 1027196613 7:76034932-76034954 ACTGAGCTGCAGACTCTAGAAGG No data
1027196606_1027196613 15 Left 1027196606 7:76034894-76034916 CCAATGATTCCCAAATTTTATCC 0: 1
1: 0
2: 3
3: 15
4: 251
Right 1027196613 7:76034932-76034954 ACTGAGCTGCAGACTCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027196613 Original CRISPR ACTGAGCTGCAGACTCTAGA AGG Intronic
No off target data available for this crispr