ID: 1027196777

View in Genome Browser
Species Human (GRCh38)
Location 7:76036061-76036083
Sequence CAGAATAGCACCAAATGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027196777 Original CRISPR CAGAATAGCACCAAATGGGA TGG (reversed) Intronic
903134199 1:21298568-21298590 CAGAGAAGCAGCACATGGGAGGG + Intronic
907675647 1:56515548-56515570 CAGAATAGCTCCAGAAAGGAAGG + Intronic
908141092 1:61185715-61185737 CAGACAAGTAGCAAATGGGATGG - Intronic
915481467 1:156188792-156188814 CAGAAGAGCCTCAAAAGGGAAGG - Intergenic
915706589 1:157849543-157849565 CAAAATAGCAGCTAATGGGTTGG + Intronic
917468726 1:175307712-175307734 CACAATAGCCCCACATAGGAAGG - Intergenic
917795579 1:178530437-178530459 CAGAGTAGCACCCCTTGGGAAGG - Intronic
922245566 1:223793489-223793511 AACAACAGCAGCAAATGGGAAGG + Intronic
923887290 1:238173172-238173194 GAGAACAGCACCAAACAGGATGG - Intergenic
924793723 1:247276891-247276913 AAGAATAGAATAAAATGGGATGG + Intergenic
1063432836 10:6006009-6006031 AAAAATCGCAGCAAATGGGAGGG + Intergenic
1066766208 10:38805168-38805190 CGGACTAGCAACAAATGGAATGG - Intergenic
1066768191 10:38821942-38821964 TAGAATGGAACCAAATGGAATGG + Intergenic
1066770590 10:38842214-38842236 TAGAATAGAATCAAATGGAATGG + Intergenic
1066776619 10:38891836-38891858 CAGAATAGAATCCAATTGGATGG + Intergenic
1066776636 10:38891986-38892008 TTGAATAGCATCAAATGGAATGG + Intergenic
1068185490 10:53580284-53580306 CACAACAGCACCAAGGGGGATGG - Intergenic
1069915879 10:71786456-71786478 CAGAGGAGCACCACATGGGAGGG - Intronic
1072757033 10:98028476-98028498 AAGAATACCACCAACCGGGAAGG - Intronic
1074338866 10:112606318-112606340 CAGAATAGCACGCAATGGCCGGG - Intronic
1077590042 11:3484199-3484221 CAGAAAAGCAGGAAATGGGTTGG + Intergenic
1077705939 11:4485702-4485724 GAGAATAGCACAAAGAGGGAAGG - Intergenic
1077921283 11:6643597-6643619 CCGAAAAGCACCAATTGTGAAGG - Intronic
1084245757 11:67855973-67855995 CAGAAAAGCAGGAAATGGGTTGG + Intergenic
1084826928 11:71738605-71738627 CAGAAAAGCAGGAAATGGGTTGG - Intergenic
1085610568 11:77945090-77945112 CAGGATAGCACCACAGGGAAGGG + Intronic
1087426347 11:97991696-97991718 CATAATAACAACAGATGGGATGG - Intergenic
1088168345 11:106965633-106965655 CAGCATAGAAGCTAATGGGAAGG - Intronic
1088208751 11:107428031-107428053 AAAAATAGCACCAAATGAGTGGG - Intronic
1091505532 12:1063798-1063820 CAGAATACCACCAAACAGCAAGG - Intronic
1091652387 12:2319773-2319795 CAGCAGAGCACTAGATGGGAAGG + Intronic
1092616547 12:10220878-10220900 CAGAATAGCAGGAACTGCGATGG - Intronic
1094815698 12:34181308-34181330 GAGGATAGTACCAAATGGGATGG + Intergenic
1095871249 12:47030581-47030603 AAGAATGGCACCAACGGGGAGGG - Intergenic
1096227986 12:49881642-49881664 CAGAAAAGCACCCAAAGAGAGGG + Intronic
1096352995 12:50915952-50915974 TACAACACCACCAAATGGGATGG + Intergenic
1096573473 12:52538358-52538380 CAGAAAATCACCAAAAGGGATGG - Intergenic
1097181279 12:57173417-57173439 CAGAGTAGCGGCAAAGGGGATGG + Intronic
1097978277 12:65710832-65710854 GAGAATAGCACCAAGAGGGATGG - Intergenic
1098525643 12:71483581-71483603 CAGCATAGCAGCAAAGGGGCTGG + Intronic
1099366475 12:81771415-81771437 GAGAGTAGCACCAAATCGCATGG + Intergenic
1100726961 12:97418911-97418933 CAGAATAGGATGGAATGGGATGG - Intergenic
1104468329 12:129007952-129007974 CAGGACAGCACCAAAGGCGATGG - Intergenic
1104873821 12:132019155-132019177 CAGACTAGCACCCACTGGAATGG - Intronic
1106807467 13:33325528-33325550 CATAATAGGACCAAAGGGAAGGG - Intronic
1107344006 13:39439673-39439695 GAGAACAGCACCAACGGGGATGG - Intronic
1107636885 13:42401086-42401108 CAGAATATCTGCCAATGGGAAGG + Intergenic
1108826801 13:54422379-54422401 GAGAACAGCACCCAAGGGGATGG - Intergenic
1109350079 13:61169044-61169066 CAGAATAAGCCCAATTGGGAAGG + Intergenic
1110267871 13:73558847-73558869 CACAATAGCACCGAAGAGGACGG - Intergenic
1111320292 13:86618840-86618862 GAGAATAGCACCCAAGGGAATGG - Intergenic
1111442808 13:88303287-88303309 AAGAACAGCACCAAGGGGGATGG - Intergenic
1113208435 13:107945020-107945042 CAAAAAAGCCCCAAATCGGATGG + Intergenic
1114723862 14:24912706-24912728 CAGAACAGCACCAGATAGCATGG - Intronic
1116744730 14:48803206-48803228 CAGAAAAGAACCAAATGTGTGGG + Intergenic
1117281640 14:54247250-54247272 CAGAAAAGCTTCAAATGGGAAGG + Intergenic
1118814006 14:69296234-69296256 GAGAACAGCACCAAGGGGGATGG + Intronic
1119442627 14:74638457-74638479 CAGAAAAGCACCAACTCTGAGGG + Intergenic
1119625891 14:76175062-76175084 CAGAATAGCAGTACATGGGGTGG + Intronic
1126052355 15:44697633-44697655 AAGAATAGAAGCAAATGAGAAGG - Intronic
1126104695 15:45139692-45139714 GAGACAAGCACCTAATGGGAGGG + Intronic
1128630853 15:69265365-69265387 CTGAATGGGAGCAAATGGGATGG - Intronic
1131731504 15:95286956-95286978 CCGCAGAGCACCAAAGGGGAGGG - Intergenic
1136065863 16:27758082-27758104 CAGAACAGCCCCAAATTAGATGG + Intronic
1136299390 16:29323415-29323437 CAGAAAATCAGCAAATAGGAAGG + Intergenic
1138118950 16:54382741-54382763 AAGAATGGGGCCAAATGGGAGGG - Intergenic
1138652145 16:58466652-58466674 CAAAATAGCAACAGAGGGGATGG - Intronic
1138849639 16:60611639-60611661 CAGCATAGAACAAAATGGGAAGG + Intergenic
1139493270 16:67298741-67298763 CAGACTGGCACCAAAATGGAAGG - Intronic
1140566302 16:76046846-76046868 GAGAACAGTACCAAAAGGGATGG + Intergenic
1141616157 16:85210792-85210814 CATCTTAGCACTAAATGGGAGGG + Intergenic
1142061135 16:88030242-88030264 CAGAAAATCAGCAAATAGGAAGG + Intronic
1144278035 17:13695712-13695734 GAGAATGGCATCAAATGGGGAGG - Intergenic
1144292057 17:13836281-13836303 GAGAACAGCACCAAGGGGGATGG + Intergenic
1145240934 17:21240801-21240823 CAGGGTAGCACCAGATGGGATGG + Exonic
1145335356 17:21907850-21907872 TAGAATAGAATCAAATGGAATGG + Intergenic
1145338516 17:21933614-21933636 TGGAATAGAACCAAATGGAATGG + Intergenic
1145696062 17:26788853-26788875 CGGAATGGCATCAAATGGAATGG + Intergenic
1145697509 17:26800727-26800749 TAGAATGGAACCAAATGGAATGG + Intergenic
1145706612 17:26877082-26877104 TAGAATGGCATCAAATGGAATGG + Intergenic
1148898702 17:50858091-50858113 CAGAATAGCAACTAATCTGAGGG + Intergenic
1149007676 17:51822326-51822348 GAGAATAGCTCGAACTGGGAGGG + Intronic
1149080773 17:52654450-52654472 CTGACCATCACCAAATGGGAAGG + Intergenic
1150825453 17:68470953-68470975 TAGATTACCACAAAATGGGAGGG + Intergenic
1150832350 17:68535455-68535477 AAGAATAGCACAAAATGGTTTGG - Intronic
1203195621 17_KI270729v1_random:228733-228755 CGGAATAGAATCAAATGGAATGG + Intergenic
1203197235 17_KI270729v1_random:243375-243397 TAGAATGGCATCAAATGGAATGG + Intergenic
1203198361 17_KI270729v1_random:252915-252937 CAGAATGGAACCGAATGGAATGG + Intergenic
1203205099 17_KI270730v1_random:29125-29147 CGGAATAGAATCAAATGGAATGG + Intergenic
1203206841 17_KI270730v1_random:44146-44168 TAGAATGGCATCAAATGGAATGG + Intergenic
1203207966 17_KI270730v1_random:53674-53696 CAGAATGGAACCGAATGGAATGG + Intergenic
1152982567 18:292677-292699 CAGAAAAGCAGCAACTGGGCTGG + Intergenic
1155344262 18:24843163-24843185 CACAACAGCACCAAGAGGGATGG + Intergenic
1156251152 18:35353486-35353508 AAGAAAAGCACCAAGGGGGATGG - Intergenic
1156390638 18:36647667-36647689 CAAAATAGCCCCAAATTGAAGGG + Intronic
1157482748 18:48066034-48066056 CAGAAGACCTCCAAATGGGTGGG - Intronic
1163126285 19:15245969-15245991 CAGCATGCCACCAAAAGGGATGG + Intronic
1164255853 19:23527540-23527562 CAGAAGAGCATAAAATGGGAAGG - Intronic
1168140177 19:54380585-54380607 GAGAACAGCACCGAAGGGGATGG - Intergenic
925476441 2:4221986-4222008 GAGAATAACACCAAAGGGGATGG + Intergenic
925684512 2:6457925-6457947 AAGAACAGCACCAAAGGGGATGG + Intergenic
926216349 2:10907901-10907923 CAGAATACCACAAACTGGGGTGG + Intergenic
927003747 2:18826308-18826330 GAGAACAGCACCAAAGGGGTTGG - Intergenic
927282292 2:21319823-21319845 CAGAGTAGCCCCATATTGGAGGG - Intergenic
928593255 2:32838297-32838319 TAGGAAAGCACCAAATGGGACGG + Intergenic
933164667 2:79063024-79063046 AGGAAAAGCACCAAATTGGATGG + Intergenic
936988878 2:118340858-118340880 CAGCATAGCACCACATGGAGAGG - Intergenic
937303630 2:120857850-120857872 CAGAGTATCAGAAAATGGGAAGG - Intronic
937487711 2:122333040-122333062 CAGAATAGCACCATCAGGGTAGG - Intergenic
937654869 2:124363241-124363263 CAGACTATCACCAAAGTGGAAGG - Intronic
938314596 2:130317195-130317217 CAAAATAACCCCAAATGGGATGG + Intergenic
939321656 2:140630491-140630513 CATCATAGCTACAAATGGGAAGG + Intronic
939373551 2:141334274-141334296 CAGAAAAGCACCCGGTGGGATGG - Intronic
940351102 2:152689519-152689541 TAGAATAATACCAAATGGGCTGG + Intronic
941743664 2:169063528-169063550 CAGAAAAGCACAAAGGGGGATGG + Intergenic
942734940 2:179098768-179098790 GAGAATAGCACAAAATGGAAGGG - Intergenic
944529353 2:200652067-200652089 CAAAATAGGAACAAATGGCAGGG + Intronic
945151077 2:206792671-206792693 CAGAATAACACCAACTTGCATGG - Intergenic
948097630 2:235349121-235349143 CATAATAACACCAAGGGGGATGG - Intergenic
1170747730 20:19115647-19115669 CAGAAGAGCAACAGATGGGAAGG + Intergenic
1171482528 20:25464851-25464873 CAGACAAACCCCAAATGGGAGGG - Intronic
1171777556 20:29383320-29383342 GAGGATAGTACCAAATGGGATGG + Intergenic
1171818841 20:29814008-29814030 GAGGATAACAACAAATGGGATGG + Intergenic
1171898977 20:30839204-30839226 GAGGATAGCACCAAATGGGATGG - Intergenic
1171918359 20:31077834-31077856 CAGAATAGGACGGAATGGAATGG + Intergenic
1171919378 20:31086072-31086094 TACAATAGAATCAAATGGGAGGG + Intergenic
1171926845 20:31195917-31195939 CAGAATAGAACGGAATGGAATGG + Intergenic
1171927879 20:31204231-31204253 TACAATAGAATCAAATGGGAGGG + Intergenic
1171930771 20:31227117-31227139 TAGAATAGAATCAAATGGAAAGG + Intergenic
1171932021 20:31237284-31237306 AAGAATGGCATCAAATGGAATGG + Intergenic
1172997650 20:39083053-39083075 CAGAACAGGACCAAGTGGCAGGG - Intergenic
1175908185 20:62392061-62392083 CAAAATAGCACACACTGGGAGGG + Intronic
1176526049 21:7919275-7919297 TGGAATGGCACCAAATGGAATGG - Intergenic
1176528802 21:7942200-7942222 TGGAATAGAATCAAATGGGATGG - Intergenic
1176747119 21:10661730-10661752 CAGAATAGAACGGAATGGAATGG - Intergenic
1179028407 21:37699482-37699504 CAGAAGAGCAAAACATGGGAAGG - Intronic
1179655659 21:42842653-42842675 CAGAATACCCGCAAAGGGGAGGG + Intergenic
1180322814 22:11338697-11338719 GAGAATAGTAACAAATGGGATGG + Intergenic
1180354136 22:11824785-11824807 CAGCATAGGGCCTAATGGGAAGG + Intergenic
1180384109 22:12167541-12167563 CAGCATAGGGCCTAATGGGAAGG - Intergenic
949214287 3:1546657-1546679 CAGAATATCACAAAATGGATGGG - Intergenic
950182522 3:10925836-10925858 CAGAATAGCACCAAACGCATGGG + Intronic
950657373 3:14444961-14444983 CAGAAAAGCACCAGCTAGGAAGG - Intronic
950965553 3:17143365-17143387 GAGAACAGCACCACAGGGGATGG - Intergenic
951228737 3:20151304-20151326 TACAATATCCCCAAATGGGAAGG - Intronic
951261547 3:20515638-20515660 CACAGTTGCTCCAAATGGGAAGG + Intergenic
951428662 3:22580638-22580660 CAGATTAAGACCAAATGGCATGG - Intergenic
953560564 3:43988064-43988086 CAGAAAAACACAAAATGGGTGGG - Intergenic
953706616 3:45235979-45236001 CACAATAGCACCAAGGGGGATGG - Intergenic
954097074 3:48337165-48337187 GAGAACAGCACCAAGGGGGATGG - Intergenic
957087649 3:75697419-75697441 GAGGATAGTACCAAATGGGATGG - Intergenic
959283147 3:104373052-104373074 GGGAACAGCACCCAATGGGAAGG - Intergenic
960422501 3:117464287-117464309 AAGAATAGCATCAGATGGAATGG + Intergenic
960429267 3:117548672-117548694 CAGAAAAGCAGAAAATGAGATGG - Intergenic
961893881 3:130151702-130151724 CAGAAAAGCAGGAAATGGGTTGG + Intergenic
962873753 3:139519900-139519922 CAGAACTGCCCCATATGGGACGG - Intronic
962997843 3:140649354-140649376 AAGAACAGCACCAAAGGGGATGG + Intergenic
964587249 3:158319620-158319642 CAGAATAACATGAAATGCGATGG - Intronic
967473564 3:189890268-189890290 CAGACCAGCACCAAAAGGAAGGG + Intronic
967692564 3:192493775-192493797 AAGAACAGCACCAAGGGGGATGG + Intronic
973016771 4:45149759-45149781 CATAATAGCATCTAATGGAATGG + Intergenic
973863452 4:55088180-55088202 AAGAAAAGCAACAAATGGGTAGG + Intronic
975860338 4:78670374-78670396 CACAACAGCACCAAGAGGGATGG - Intergenic
978121033 4:105079719-105079741 GAGAATAGCACCAAGGGAGATGG + Intergenic
978131632 4:105205513-105205535 CAGAATAGTACCTATTGGGTTGG - Intronic
981089975 4:140722167-140722189 CATAATAGCTTCAAATGGCATGG + Intronic
981716146 4:147754298-147754320 TACAATAGCAACAAATGGTATGG - Intronic
982544619 4:156718590-156718612 GAGAATCGCTCGAAATGGGAAGG + Intergenic
982740985 4:159056764-159056786 CAGAAAAGCAACAAGTGGGGTGG + Intergenic
983494716 4:168429756-168429778 GAGAACAGCACCAAGTGGGATGG - Intronic
984876392 4:184371641-184371663 CAGAATGGCTCCAGAAGGGAGGG - Intergenic
985443326 4:190001397-190001419 GAGGATAGTACCAAGTGGGACGG + Intergenic
986093578 5:4534990-4535012 GAGAACAGCACCAAAGTGGAAGG + Intergenic
987393271 5:17397117-17397139 CACAACAGCACCCAGTGGGATGG + Intergenic
987592917 5:19955314-19955336 CACAATAGCATCAAATATGATGG + Intronic
989273710 5:39561923-39561945 CAGAATAGCATCATATTGGATGG - Intergenic
992721068 5:79561751-79561773 TAGAATAGCACCAAGGGGGATGG + Intergenic
993869756 5:93238664-93238686 GAGAACAGCACCCAGTGGGATGG + Intergenic
994798040 5:104331749-104331771 CAGAATGGCACCAAATGGGACGG + Intergenic
999133417 5:149301300-149301322 CAGGAGAGCACCCAGTGGGAAGG - Intronic
1000880662 5:166693222-166693244 CAGAATAACACCAATTGTCAGGG - Intergenic
1001419058 5:171573295-171573317 AATAATAGCACCAAATGTGCAGG - Intergenic
1001767377 5:174261254-174261276 AAGAACAGCACCAAGGGGGATGG + Intergenic
1001906971 5:175480646-175480668 CAGAAAGGCACCAACTGGCAGGG + Intronic
1002909987 6:1482710-1482732 AAGAATAGCACAAAACAGGAAGG - Intergenic
1003011579 6:2432226-2432248 CAGAATAGTGTCAACTGGGAGGG + Intergenic
1004397409 6:15257939-15257961 CAGAACAGCTCCAGAAGGGAAGG + Intronic
1005570192 6:27137987-27138009 AAGAAAATCACCAAATGGGCCGG + Intergenic
1007234533 6:40380816-40380838 CAGAATAACACCACCTGGCAGGG + Intergenic
1008699334 6:54079971-54079993 CAGCATAGCACGGGATGGGAAGG + Intronic
1012135302 6:95548458-95548480 CAGAATTGCAGGAAATGGAAAGG - Intergenic
1012347081 6:98203066-98203088 AAGAGTACCATCAAATGGGAAGG - Intergenic
1012782965 6:103586533-103586555 AAGAACAACAACAAATGGGAAGG - Intergenic
1015152127 6:130051950-130051972 CAGACTGTCCCCAAATGGGAAGG - Intronic
1015844052 6:137499109-137499131 CAGAATAGCACAAAATGATGAGG + Intergenic
1016180359 6:141139129-141139151 TAGAATAGCACAAAGGGGGATGG - Intergenic
1017234899 6:152109131-152109153 AAGGATAGCACCAGAGGGGATGG + Intronic
1017298712 6:152831369-152831391 AAGAGTATCACAAAATGGGAAGG - Intergenic
1018727343 6:166623836-166623858 CAGCATAGAACCAAGTGAGATGG - Intronic
1021854032 7:24835955-24835977 AAGCATAGCACCAAATAGGTAGG - Intronic
1022282916 7:28928749-28928771 CAGAATAACAACTGATGGGATGG + Intergenic
1024329356 7:48140902-48140924 CAGAAGAGCATAAAAAGGGAGGG + Intergenic
1024412705 7:49064343-49064365 CAGAAAAGCACCAAGTGAAAAGG + Intergenic
1026979601 7:74518581-74518603 CAAAATAGCACCAAAGTGGTCGG + Intronic
1027196777 7:76036061-76036083 CAGAATAGCACCAAATGGGATGG - Intronic
1028778618 7:94708121-94708143 CAGAAGAGCACTCAAAGGGATGG + Intergenic
1030774927 7:113522818-113522840 CAAAATAGGACCAAATAGGAAGG + Intergenic
1032281305 7:130504400-130504422 GAGAATAGCAACCAATGAGAAGG - Intronic
1033645997 7:143304871-143304893 CAGGAGAGCAGCAAACGGGAAGG - Intronic
1034602707 7:152277394-152277416 CAGAATGGGAGAAAATGGGAGGG + Intronic
1034910019 7:154988247-154988269 CAGAATTGGAGGAAATGGGAAGG - Intronic
1034939945 7:155224104-155224126 AAGAATATCCCCAAATGAGAAGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1044216542 8:89618456-89618478 CAGGATGGCACCCAATGGGGAGG + Intergenic
1045714195 8:105022444-105022466 AAGAACAGCACCAACGGGGATGG + Intronic
1046957287 8:120074630-120074652 AAAAATATCACCAAATGGGGCGG - Intronic
1047587900 8:126294037-126294059 TAGAATGGCAGCAAATAGGAGGG - Intergenic
1048073798 8:131046799-131046821 CAGGATAGGACCACATGGGTAGG - Intergenic
1049776984 8:144410764-144410786 CAGAATAGAACAAAAGGGAATGG - Intronic
1051845028 9:21442104-21442126 CATGACAGCACCAAAGGGGATGG - Intergenic
1056141545 9:83685133-83685155 CAGAATAGCACCAAAATAGAAGG + Intronic
1059389216 9:113988340-113988362 CAGAAGAGCACCAAGGTGGAGGG + Exonic
1059484199 9:114614399-114614421 CAGCATTAAACCAAATGGGAGGG - Intronic
1203388160 Un_KI270438v1:73547-73569 TGGAATAGAATCAAATGGGATGG + Intergenic
1203389887 Un_KI270438v1:87940-87962 TAGAATAGAATCAAATGGAATGG + Intergenic
1203370503 Un_KI270442v1:299276-299298 GAGAATAGTAACAAATGGGATGG + Intergenic
1203673983 Un_KI270756v1:5957-5979 CGGAATGGCATCAAATGGAATGG - Intergenic
1203675897 Un_KI270756v1:22181-22203 TTGAATAGCATCAAATGGAATGG - Intergenic
1203675914 Un_KI270756v1:22331-22353 CAGAATAGAATCCAATTGGATGG - Intergenic
1203682215 Un_KI270756v1:74143-74165 TAGAATAGAATCAAATGGAATGG - Intergenic
1185840042 X:3380719-3380741 CAGAACTGCTCCAAATTGGAGGG - Intergenic
1187122301 X:16421222-16421244 GAGAACAGCACCAAGGGGGATGG + Intergenic
1189103428 X:38213883-38213905 AAAAATAACACCAAAGGGGATGG + Intronic
1189570719 X:42293158-42293180 GAGAACAGCACTAAAGGGGAGGG - Intergenic
1190969847 X:55337860-55337882 CAGACTAGCACCAAATCTAAGGG + Intergenic
1191773382 X:64785939-64785961 CAGAAGAGCATAAAAAGGGAAGG - Intergenic
1193102924 X:77636299-77636321 AAGAATAGCACCAAAGGGGATGG - Intronic
1193639416 X:83993940-83993962 GATAACAGCACCAAGTGGGATGG - Intergenic
1193718727 X:84963121-84963143 CAGCAGAGCAGCAAATGGAAAGG - Intergenic
1194618471 X:96137416-96137438 GAGAACAGCACCAAGTAGGATGG - Intergenic
1194672426 X:96751131-96751153 AAGAATAGGATCAAATGAGAAGG - Intronic
1195155143 X:102115609-102115631 CAGGAAAGCCCCAAATGGCAGGG + Intergenic
1195524852 X:105875123-105875145 GAGAATAGAACCAAATGCAAAGG - Intronic
1196365538 X:114919279-114919301 GAGAACAGCACCAAGAGGGATGG - Intergenic
1197888064 X:131238680-131238702 GAGAAAAGCACAAAATGGGGTGG + Intergenic
1199180693 X:144850330-144850352 CAGACTAGAAAAAAATGGGATGG + Intergenic
1199223991 X:145350792-145350814 AAGAATAGCACAAAGTGGAAGGG + Intergenic
1201067808 Y:10115805-10115827 GAGGATAGCACCAAATGGGATGG - Intergenic
1201115894 Y:10835145-10835167 CAGAATAGAATGAAATGGAATGG - Intergenic
1201116129 Y:10836707-10836729 GAGAATGGCACGAAATGGAATGG - Intergenic
1201200042 Y:11531405-11531427 TGGAATAGCATCAAATGGAATGG + Intergenic
1201200072 Y:11531749-11531771 GAGAATAGAATCAAATGGAAAGG + Intergenic
1201209089 Y:11662886-11662908 CAGAATGGAATCAAATGGAATGG + Intergenic
1201211389 Y:11683949-11683971 CGGAATGGCATCAAATGGAATGG + Intergenic
1201212195 Y:11690865-11690887 TAGAATGGAATCAAATGGGATGG + Intergenic
1201760510 Y:17531960-17531982 GAGGATAGTACCAAATGGGATGG + Intergenic
1201841044 Y:18374030-18374052 GAGGATAGTACCAAATGGGATGG - Intergenic
1202029647 Y:20558239-20558261 CAGAATCCCACAAAATAGGAGGG + Intergenic
1202038444 Y:20658847-20658869 CAGAATAGCCTAAAAAGGGAAGG + Intergenic
1202613657 Y:56701474-56701496 CAAAATAGGATCAAATGGAATGG + Intergenic
1202614271 Y:56706632-56706654 CGGAATGGCATCAAATGGAATGG + Intergenic
1202614910 Y:56712141-56712163 CAAAATAGGATCAAATGGAATGG + Intergenic
1202622403 Y:56827677-56827699 CAGAATGGAATCAAATCGGATGG - Intergenic