ID: 1027198241

View in Genome Browser
Species Human (GRCh38)
Location 7:76046348-76046370
Sequence GCGCGCGCGCGCTTTTGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 48}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027198241 Original CRISPR GCGCGCGCGCGCTTTTGAGC CGG Intronic
907526480 1:55056869-55056891 GCGCGCGCGCGCGTTGGGGGTGG + Intronic
908501103 1:64744889-64744911 GCGCGGGCGCGCCTGTGCGCCGG + Intergenic
915172300 1:153986410-153986432 GCCCGCCCACCCTTTTGAGCAGG + Intergenic
1076884870 10:133257689-133257711 GAGGGCGCGCGCTTTCTAGCTGG + Intergenic
1084265727 11:68004199-68004221 GCGCGCGCGCGCGTGTGTGCAGG + Intronic
1085699884 11:78736480-78736502 GCGCGCGCGTGCATGTGAGTAGG + Intronic
1089102570 11:115975878-115975900 GCGCGCGCGCGCGCATGAACTGG + Intergenic
1092108896 12:5945244-5945266 GCGGCCGCGCGCTTCTGGGCAGG + Exonic
1095180863 12:39145230-39145252 GTGGGCGCGCGCTTTCGCGCCGG - Intergenic
1097264625 12:57738214-57738236 GCGCGGGCGCGCTTCAGCGCCGG - Exonic
1125270537 15:37934103-37934125 GCGCGCGCGCGCGTGTGTGTAGG - Intronic
1125698599 15:41660414-41660436 GCGCGCGCAGGCTCTTCAGCTGG + Exonic
1135732361 16:24905615-24905637 GCGCGCGCGTGTTTTTGAGATGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143591654 17:7888738-7888760 GCGCGCGCGTGCTTTTGAGAAGG + Intronic
1144775344 17:17782313-17782335 GCGCGCGCGAGCTTCCCAGCCGG - Intronic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1149490973 17:57085145-57085167 GCGCGCACGCGCAGGTGAGCGGG + Intronic
1150354366 17:64470549-64470571 GCCCGCGAGCGCTCTTGAGAAGG - Intergenic
1151058703 17:71064982-71065004 GCGCGCGCGCGCCTGTGTGTAGG - Intergenic
1156000355 18:32378058-32378080 GCGCGCGGGCGCTTTGGAGGAGG + Intronic
1156238926 18:35232800-35232822 GCGCGCGCGCACTTATTAGCTGG + Intergenic
1158604224 18:58880741-58880763 GTGCGCGCGCGCCTATGAGAGGG - Intronic
1165157569 19:33797290-33797312 GCGCGCGCGCGCGCTTGTGGAGG + Intronic
1165696730 19:37906694-37906716 GCGCGCGCGCGTTCTCGCGCCGG - Intergenic
931869059 2:66440040-66440062 GCGCGCGCGCGCGTGTGTGTTGG - Intronic
932234318 2:70108908-70108930 GCGCGCGCGTGCTTGTGTGTGGG + Intergenic
945699433 2:213151796-213151818 GCGCGCGCGTGCGTGTGTGCGGG + Intronic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1173548118 20:43914723-43914745 GCCCGCGCGCGCTATTGTTCCGG - Intergenic
1176550494 21:8218947-8218969 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1176577336 21:8446217-8446239 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
1203255391 22_KI270733v1_random:135288-135310 GCGCGCGCGCGCGTGCGTGCGGG + Intergenic
960465936 3:117996887-117996909 GTGCGCGCGCGCGTGTGAACGGG - Intergenic
961377412 3:126475979-126476001 GCGCACGCGCGGTTCCGAGCCGG - Intergenic
973635877 4:52861965-52861987 GCGCGCGTGGGCTGTGGAGCCGG + Intergenic
976475319 4:85475795-85475817 GCGCGCGCGCATGTTTGTGCCGG + Intronic
977184353 4:93917808-93917830 GCGCGCGCGCGCTCTAGCTCTGG + Intergenic
990210780 5:53480175-53480197 GCGCGCGCGCGAGTGTGAGAGGG - Intergenic
998083355 5:139294464-139294486 GCGCGCGCGCGCGTGTGGGCCGG - Intronic
1002559738 5:180072910-180072932 GCGCGCGCGCGCGTTTCGGAAGG - Intergenic
1004660653 6:17706481-17706503 GCGCGGGCGGACTTTTGGGCCGG - Exonic
1013836422 6:114341593-114341615 GCGCGCGCGCGCGTGTGTGTTGG + Intronic
1020037585 7:4974180-4974202 GCGCGCTCGAGCTTCTGGGCGGG + Intergenic
1027198241 7:76046348-76046370 GCGCGCGCGCGCTTTTGAGCCGG + Intronic
1032036136 7:128522799-128522821 GTGCACGCGCGCGTTTGAGAGGG + Intergenic
1033197499 7:139340390-139340412 GCGCATGCCCGCTTTTGCGCAGG + Intronic
1039979102 8:42391692-42391714 GCGCACGCGCGCTGCGGAGCCGG + Intronic
1043769585 8:84182493-84182515 GTGCGCCCGTGCTTCTGAGCTGG - Intergenic
1047423563 8:124727075-124727097 GCGCGCGCGCGCGTGGGGGCGGG - Intronic
1057773290 9:97984844-97984866 GGGCGCGCGGGATTTTGGGCGGG + Intronic
1062316145 9:135967812-135967834 GCGCGCGCGCGCCTGTGTGTGGG + Intergenic
1189310506 X:40014432-40014454 GCGCGCGCGCGCTCGAGTGCCGG + Intergenic
1197735083 X:129844189-129844211 GCGCGCGCGCGCGTGTGTGTAGG - Intergenic
1200473072 Y:3609845-3609867 GCGCGCGCGCGCTTCTAGGATGG + Intergenic