ID: 1027201897

View in Genome Browser
Species Human (GRCh38)
Location 7:76069251-76069273
Sequence CCTGGAAGGCAGGAGCTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027201897_1027201905 24 Left 1027201897 7:76069251-76069273 CCCTCTAGCTCCTGCCTTCCAGG No data
Right 1027201905 7:76069298-76069320 AATCCACAAGACAAACACAGAGG No data
1027201897_1027201903 -6 Left 1027201897 7:76069251-76069273 CCCTCTAGCTCCTGCCTTCCAGG No data
Right 1027201903 7:76069268-76069290 TCCAGGGCTAAAGACGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027201897 Original CRISPR CCTGGAAGGCAGGAGCTAGA GGG (reversed) Intergenic
No off target data available for this crispr