ID: 1027202213

View in Genome Browser
Species Human (GRCh38)
Location 7:76071512-76071534
Sequence AGCCGAAGGCGGGGCCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 2, 2: 5, 3: 20, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027202199_1027202213 29 Left 1027202199 7:76071460-76071482 CCACGGAGAAACCGCTGTCAGGC 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG 0: 1
1: 2
2: 5
3: 20
4: 223
1027202203_1027202213 18 Left 1027202203 7:76071471-76071493 CCGCTGTCAGGCAGTGGCTGGGA 0: 1
1: 0
2: 4
3: 75
4: 366
Right 1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG 0: 1
1: 2
2: 5
3: 20
4: 223
1027202197_1027202213 30 Left 1027202197 7:76071459-76071481 CCCACGGAGAAACCGCTGTCAGG 0: 1
1: 0
2: 0
3: 2
4: 39
Right 1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG 0: 1
1: 2
2: 5
3: 20
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027202213 Original CRISPR AGCCGAAGGCGGGGCCTGAG AGG Intergenic
900094840 1:936157-936179 AGACGTAGGCGTGGCCTCAGAGG + Intronic
900112291 1:1013487-1013509 TGCCGAAGCCGGCGGCTGAGAGG + Exonic
900397853 1:2460540-2460562 AGCCAAAGGCAGGGGCTTAGTGG + Intronic
900527159 1:3134981-3135003 ACCCGCAGGCTGGGCCTGGGAGG + Intronic
901134167 1:6982464-6982486 AGCGGGAGGAGGGGCCAGAGTGG + Intronic
901306998 1:8239900-8239922 CGCTGGAGGAGGGGCCTGAGAGG + Intergenic
904003421 1:27351028-27351050 TGTCGAAGGCGGGGTGTGAGGGG - Intronic
904847500 1:33431029-33431051 AGCCGAGGGGGCGGGCTGAGGGG - Intronic
906197260 1:43936732-43936754 AGCCGCAGGCGGTGGCGGAGAGG - Exonic
906734937 1:48116290-48116312 AGCAGAGAGGGGGGCCTGAGAGG - Intergenic
907201400 1:52729785-52729807 AACTGAGGGCAGGGCCTGAGAGG + Intronic
912422002 1:109548845-109548867 GGCTGGAGGCGGGGACTGAGTGG + Intronic
914758475 1:150579799-150579821 GGCCTGAGCCGGGGCCTGAGCGG + Intergenic
915217627 1:154350581-154350603 TGCCAGAGGCTGGGCCTGAGGGG - Exonic
915507482 1:156366928-156366950 GGCAGAAGGCTGGGCCTGGGTGG + Intronic
915586910 1:156848893-156848915 TGCCGGGGGCGGGGCCGGAGCGG - Intronic
916124343 1:161555989-161556011 AGCTGAAGGCAGGAGCTGAGGGG + Intergenic
916134227 1:161637347-161637369 AGCTGAAGGCAGGGGCTGAGGGG + Intronic
918042457 1:180921590-180921612 AGCCCAAGGGGTGGCCTGTGGGG - Intronic
919820171 1:201467732-201467754 AGTGGAAGGTGGGGCCTCAGTGG - Intronic
920442379 1:205989623-205989645 AGCAGGAGGAAGGGCCTGAGGGG - Intronic
922056091 1:222043813-222043835 AGCCGCAGGCTGGGCAGGAGGGG + Intergenic
922119036 1:222644234-222644256 CGGCGAGGGCGGGGCCAGAGCGG - Intronic
923147595 1:231209113-231209135 CCCCGAAGGCGGGGTCTGGGTGG - Exonic
1067473250 10:46550678-46550700 GGCTGAAGGCGGGGGCTCAGGGG + Exonic
1070258065 10:74827068-74827090 GTCGGAAGGCGGGGGCTGAGAGG + Intronic
1071875404 10:89838025-89838047 AGACGAAGGCGGGGGGTGAGAGG + Intergenic
1072336715 10:94403659-94403681 AGCCGGAGCCGGAGCCGGAGCGG + Intronic
1075562596 10:123479225-123479247 ACCCAGAGGCTGGGCCTGAGCGG - Intergenic
1076749992 10:132537747-132537769 AGCCCGGGGCGGGGCCTGGGCGG - Intergenic
1076903215 10:133350075-133350097 AGCCTGAGGGGGGGCCAGAGAGG - Exonic
1078999355 11:16738459-16738481 AGCCGAAGGCGGGGCCTCTGAGG + Exonic
1079094010 11:17499612-17499634 AGAAGAAGGTGGGGCCTGGGTGG + Intronic
1081940455 11:46936918-46936940 AGGCGGGGGCGGGGTCTGAGTGG + Intronic
1083684503 11:64368423-64368445 AGGCGAAGGCGGCGCGTCAGAGG - Intronic
1083684719 11:64369364-64369386 GGCCGGGGGCGGGGCCTGGGTGG + Intronic
1083800533 11:65044070-65044092 AGCCAAAGGCTGGCCCTTAGAGG + Intronic
1083940001 11:65890692-65890714 AGCCGGAGCCCGAGCCTGAGTGG + Exonic
1084089502 11:66870723-66870745 AGCTGGAGGCGGGAGCTGAGAGG - Intronic
1084151244 11:67289004-67289026 AGAGGAAGGCGGGGCCGGAGGGG - Intronic
1084265668 11:68003999-68004021 ACCCGATGGCGGGGGCTGCGGGG - Exonic
1084527047 11:69704143-69704165 GGCCGGAGGCGGGGTGTGAGTGG - Exonic
1089090634 11:115871870-115871892 ACCAGAAGGTGGGACCTGAGAGG + Intergenic
1089573006 11:119422625-119422647 TGCCGCAGGCGGGGACTGGGTGG - Intronic
1092318010 12:7440141-7440163 AGCAGGCGGCGGAGCCTGAGCGG - Intronic
1095480638 12:42631482-42631504 AGCTGAAGGCAGGGCATGATGGG + Intergenic
1096229561 12:49889492-49889514 AGCTGAAGACGGTGACTGAGAGG + Exonic
1096977517 12:55707934-55707956 GGCCGGAGGCGGGGCCTGAGTGG - Intronic
1097019184 12:56007786-56007808 AGCCGGGGGCGGGGCCTGAGGGG + Intronic
1098166287 12:67702055-67702077 AGAGGAAGGTGGGGCATGAGGGG - Intergenic
1101340934 12:103841319-103841341 AGCCGGAGGCGGGGTCTAACGGG + Intergenic
1102180828 12:110911238-110911260 GGCTGTGGGCGGGGCCTGAGTGG + Intronic
1112580863 13:100675109-100675131 AGGCGGAGGCGGGGCCGGGGCGG + Intergenic
1112719882 13:102231459-102231481 AGCAGAAGGCAGGGTCTGTGGGG + Intronic
1117758986 14:59006241-59006263 TGCAGAAGGAGGGCCCTGAGAGG + Intergenic
1118992353 14:70808740-70808762 AGGCGAAGGCGGGGCCGGGCGGG - Intronic
1119771034 14:77220874-77220896 AGTGGGAGGCGGGGCGTGAGTGG - Intronic
1119771040 14:77220892-77220914 AGTGGGAGGCGGGGCGTGAGTGG - Intronic
1119771153 14:77221248-77221270 AGTGGGAGGCGGGGCGTGAGTGG - Intronic
1119851834 14:77871735-77871757 AGCTGAAGGGGAGGTCTGAGGGG + Intronic
1122486864 14:102087459-102087481 AGCGGAACGCGGGGCCGGGGTGG + Intronic
1122603049 14:102930662-102930684 GGCCGAGGCCGAGGCCTGAGCGG + Exonic
1122802452 14:104238474-104238496 AGCCCAGGACGGGGCCAGAGAGG - Intergenic
1122880736 14:104689515-104689537 GGCCGGGGGCGGGGCCTGGGGGG - Intergenic
1123680297 15:22758018-22758040 GGCCGAACGGGGGGCCTGCGCGG + Intergenic
1125001043 15:34770219-34770241 TGCAGAAGGCTGTGCCTGAGGGG - Intergenic
1125722987 15:41853988-41854010 GCCCGAAGGCGGTGGCTGAGGGG - Intronic
1126457391 15:48878367-48878389 AGCCAATGGCGGCGCCAGAGGGG + Exonic
1128153507 15:65377724-65377746 AGCAGGAGCCGGGGCCAGAGCGG + Exonic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132669796 16:1097914-1097936 AGCTGCAGGCCAGGCCTGAGTGG + Intergenic
1132780683 16:1623221-1623243 AGCCCAAGGCTGGGTGTGAGGGG - Intronic
1132799045 16:1742475-1742497 AGCCGGAGCCTGAGCCTGAGGGG - Intronic
1132877932 16:2148573-2148595 GGCGGGAGGCCGGGCCTGAGTGG + Intronic
1136241826 16:28949374-28949396 AGGCCAAGGCGGGGGCGGAGGGG + Intergenic
1136910043 16:34137009-34137031 AGGCGAAGGTGGGGCCAGATCGG + Intergenic
1137590602 16:49691057-49691079 AGCCGTCGGAGGGGGCTGAGCGG + Intronic
1137683317 16:50369105-50369127 GGCCGAGGGCGGGGCCGGGGCGG + Intergenic
1138178744 16:54928896-54928918 AGCCGGGGGCGGGCGCTGAGGGG + Intergenic
1139692262 16:68648766-68648788 ACCAGAAAGCAGGGCCTGAGTGG + Intronic
1142165329 16:88583841-88583863 AGGACAAGGAGGGGCCTGAGTGG - Intronic
1142203253 16:88770990-88771012 ATCTGCAGGCGGGGCCTGGGCGG + Intronic
1142811948 17:2399646-2399668 GGCCGGGGGCGGGGCCTGGGCGG - Intronic
1143135659 17:4710933-4710955 TGCAGAAAGCGAGGCCTGAGGGG + Intronic
1143183403 17:4997590-4997612 GTCTGAGGGCGGGGCCTGAGCGG + Intronic
1143509921 17:7389846-7389868 AGCTGAAGGCAGGGCCCTAGTGG + Exonic
1143670496 17:8392897-8392919 AGCAGAAGGCGCGGGCGGAGCGG + Exonic
1144062869 17:11598981-11599003 GGACGGAGGCGGGGCCAGAGGGG + Intronic
1144681371 17:17197807-17197829 AGGTGCAGGCAGGGCCTGAGTGG + Intronic
1144774591 17:17778895-17778917 AGCTGGAGGTGAGGCCTGAGGGG + Intronic
1144782955 17:17816999-17817021 AGTACACGGCGGGGCCTGAGTGG + Exonic
1145190729 17:20841165-20841187 AGCCCAAGCCGGGGCCTGGTGGG + Intronic
1147999794 17:44380924-44380946 AGCCAAAGGCAGAGCCTGTGGGG + Exonic
1148348745 17:46923162-46923184 AGCCGGAGCCGTGGCCTGCGGGG + Exonic
1148818222 17:50345989-50346011 GGCCGGGGGCGGGGCCTGCGGGG - Intergenic
1151497307 17:74466610-74466632 AGCAGAAGTCGGGGCCTTGGAGG + Exonic
1152088145 17:78232445-78232467 AGCCGGAGGAGGGGGCTGTGGGG + Intronic
1152331928 17:79678488-79678510 AGCAGAAGGCTGGGCGTCAGGGG + Intergenic
1152650055 17:81488507-81488529 AGACCAAGGCAGGGCCAGAGGGG - Intergenic
1153911464 18:9709015-9709037 AGCCGAGGGCGCGGCCGGGGTGG + Intronic
1154358648 18:13641750-13641772 AGCCGAGGGCCGGGCCTCGGGGG + Intronic
1156448589 18:37254046-37254068 GGCCGGGGGCGGGGCCCGAGGGG - Intronic
1157478114 18:48036270-48036292 AGCAGCAGGCAGGGCCTTAGGGG + Intronic
1157582091 18:48779575-48779597 AGCCCAAGGCCTGGCCTGTGGGG - Intronic
1157763484 18:50281546-50281568 AGCCAGAGGCGGAGCCCGAGAGG - Exonic
1160594508 18:79964580-79964602 GGGCGGAGGCGGGGCCGGAGCGG - Exonic
1160861109 19:1237567-1237589 AGGCTGGGGCGGGGCCTGAGCGG + Intronic
1161063774 19:2227869-2227891 AACCGAGGCCGGGGCCTGAAAGG - Intronic
1161168150 19:2799662-2799684 AGAGAAAGGCGGGGCGTGAGGGG - Intronic
1161852557 19:6745172-6745194 AGGCGAAGGCGGGGGCAGGGTGG + Intronic
1162123591 19:8487152-8487174 AGCCGACGGAGGGGGCTGGGAGG - Intronic
1162373313 19:10291421-10291443 AACAGAAGGTGGGGCCTGAAGGG - Intronic
1163466473 19:17470856-17470878 GGGCGGGGGCGGGGCCTGAGAGG + Intronic
1163579892 19:18132076-18132098 CGCGGAGGGCGGGGCCAGAGAGG + Intronic
1163583301 19:18150950-18150972 AGGCCAAGGCAGAGCCTGAGGGG - Exonic
1165022608 19:32936452-32936474 ACCTGAAGGCGGGGCCTCACCGG - Intronic
1165793492 19:38505945-38505967 AGGTGAAGGCGGGGCCTGGGTGG + Exonic
1165890992 19:39112172-39112194 AGCCCAAGAAGGGGCCTGGGAGG - Intergenic
1166120393 19:40682882-40682904 AGCTGAAGGCGGTGAGTGAGGGG - Exonic
1166168092 19:41006540-41006562 AGTCAGAGGTGGGGCCTGAGAGG + Intronic
1166375694 19:42325749-42325771 AGCCGGGGGCGGGGCGCGAGCGG - Intronic
1167074337 19:47239782-47239804 AGCGGCGGGCGGGGCCTGGGGGG - Intergenic
1167077326 19:47257476-47257498 AGCCGTGGGCGGGGCCAGAGCGG + Intronic
1167215288 19:48160471-48160493 AGCAGCAGGAGGGGCCTGGGAGG + Intronic
1167268067 19:48493306-48493328 AGCCCAGGGCGGGGCCTGGAGGG - Intronic
1167444211 19:49527962-49527984 TGCCAGAGGCGGGGCCTGACTGG + Exonic
1167445287 19:49533881-49533903 GGCCGAGGGCGGGGCCGGCGCGG + Intronic
1167926075 19:52821753-52821775 CGCAGAGGGCGGGGCCGGAGCGG + Intronic
1167930259 19:52857739-52857761 CGCAGAGGGCGGGGCCGGAGCGG + Intergenic
1167987804 19:53333607-53333629 GGCAGAAGGCGGGGCCGGGGTGG - Intergenic
1168241578 19:55091635-55091657 AGCTGAAGGTGGGGGCTGTGGGG - Exonic
925675624 2:6358320-6358342 AGCCGAAGGCAGGAGGTGAGAGG + Intergenic
926202710 2:10812964-10812986 AGCGGAAGGCGGGGCCTGCTGGG + Intronic
926287486 2:11501286-11501308 GGCAGAAGGGTGGGCCTGAGAGG + Intergenic
927677507 2:25117187-25117209 AGCCGCAGGCAGGGGCTGACGGG - Intronic
933986408 2:87595621-87595643 AGCCGCAATCCGGGCCTGAGAGG + Intergenic
936307429 2:111355180-111355202 AGCCGCAATCCGGGCCTGAGAGG - Intergenic
939438962 2:142218528-142218550 TGCCGAAGGTGGAGGCTGAGTGG - Intergenic
946409815 2:219510372-219510394 AGCCACAGCGGGGGCCTGAGTGG - Intergenic
948044284 2:234931215-234931237 AGCCGAAGGCGGGGCCAAAGTGG + Intergenic
1169262451 20:4148771-4148793 AGCGGAGGGCCGGGCCGGAGCGG + Exonic
1170568388 20:17619472-17619494 AGCCCAACGAGGGGCCTGTGAGG + Intronic
1172221118 20:33275895-33275917 AGCCCAGGGCAGGGCCAGAGAGG - Intronic
1173304139 20:41831755-41831777 AGCCAAAGGAGAGTCCTGAGGGG + Intergenic
1173495541 20:43514920-43514942 AGGCGGAGGCAGGGCCTGAGGGG + Intronic
1176129509 20:63490757-63490779 AGGGGAAGGTGGGGCCCGAGGGG + Intronic
1178601505 21:33998819-33998841 AGCCTAAGCCGAGGCCTGAGCGG + Intergenic
1179833407 21:44012405-44012427 AGCCGGAGCCCGAGCCTGAGCGG - Exonic
1180338930 22:11601848-11601870 AGGCGAAGGTGGGGCCAGATCGG + Intergenic
1180754368 22:18150118-18150140 AGACCAAGGCGGGCCCGGAGCGG + Exonic
1180866495 22:19122657-19122679 GGCCGGGGCCGGGGCCTGAGCGG + Intergenic
1180951333 22:19721988-19722010 AGACGTGGGCGGGGCCAGAGGGG - Intronic
1181586971 22:23857979-23858001 ATTCGAAAGAGGGGCCTGAGCGG - Intronic
1182198029 22:28539221-28539243 AGAGGAAGGCGGGGGCTGACAGG + Intronic
1183185451 22:36289151-36289173 AGCAGAAGGCGGAGCTGGAGCGG - Exonic
1184286962 22:43477311-43477333 AGCCCCAGACAGGGCCTGAGAGG - Intronic
1184568901 22:45309988-45310010 AGCCGGAGTCGGAGCCAGAGCGG - Intronic
1184602542 22:45552156-45552178 CGCCGAAGGCGGAGCCTGTGCGG - Intronic
951191087 3:19772491-19772513 TGATGGAGGCGGGGCCTGAGGGG + Intergenic
952240991 3:31531955-31531977 AGCCGGAGGCGGGACGTGAAGGG + Intergenic
953237432 3:41118927-41118949 AGCCCAAGGCAGGGGCTGTGTGG - Intergenic
953913250 3:46903423-46903445 GGCAGTAGGCGGGGGCTGAGGGG - Exonic
954063574 3:48088742-48088764 AGCCGCAGGCGGGGTCCGATTGG - Intronic
954676269 3:52317357-52317379 AGCGGAAGCGGCGGCCTGAGTGG + Intronic
956978989 3:74614673-74614695 AGCCGGAGCCGGAGCCGGAGTGG - Intergenic
963335671 3:143971769-143971791 AGCCGGGGGCGGGGCCAGAGGGG - Intergenic
964209834 3:154214457-154214479 AGCAGAGGGAGGGGTCTGAGTGG + Intronic
968067183 3:195765140-195765162 AGCCCCAGCCTGGGCCTGAGTGG - Intronic
968510556 4:993649-993671 AGCGGGAGGCGGGGGCTCAGGGG + Intronic
968519949 4:1030721-1030743 AGCTGCATGCTGGGCCTGAGTGG + Intergenic
968616736 4:1580786-1580808 AGTGGGAGGCGGGGCCTGGGTGG - Intergenic
968916232 4:3498118-3498140 AGCCCAGGGCGGGGTCTGGGAGG + Intronic
969604755 4:8196840-8196862 GGCCCAAGGAGGGGGCTGAGAGG + Intronic
971556161 4:28014637-28014659 AGCCCAAGCTGGGGTCTGAGGGG + Intergenic
974385607 4:61200336-61200358 AGGCGCAGCCGGGGCCGGAGCGG - Intergenic
976398435 4:84582707-84582729 AGGCGGAGGCGGGGCCAGCGCGG - Intergenic
978503528 4:109433797-109433819 AAGGGAAGGCGGGGCCGGAGAGG - Exonic
978621294 4:110636869-110636891 GCCCGAAAGCCGGGCCTGAGAGG + Intronic
985520490 5:371970-371992 AGCCCTCGGCGGGGCCTGAGTGG - Intronic
985665401 5:1179420-1179442 AGAGGCAGGCGGGGCCTGTGGGG + Intergenic
990923498 5:60993953-60993975 ACCTGAAGGTGGGGCCTCAGTGG + Intronic
992105512 5:73447181-73447203 GGGCGAGGGCGAGGCCTGAGCGG + Exonic
997326576 5:133026615-133026637 AGACGTAGGCGGGGCCAGACAGG + Intergenic
998747061 5:145272989-145273011 AGCAGCAGGTGGGGCCAGAGAGG + Intergenic
999427575 5:151500946-151500968 AGGAGAAGGCGGGGCCTGGTGGG + Intergenic
1001191552 5:169637213-169637235 AGGAGAGGGCGGGCCCTGAGAGG + Intergenic
1003085000 6:3053833-3053855 AGCCGGAGGCGGGGTGTGGGCGG - Intergenic
1003981923 6:11397864-11397886 AGACTAAGGAGTGGCCTGAGAGG + Intergenic
1006047187 6:31308095-31308117 AGCCGGAGGCGGGGCCAGGGAGG + Intronic
1006364641 6:33608267-33608289 AGCCAAAGCAGGGGCATGAGGGG - Intergenic
1006634576 6:35452640-35452662 CGCTGCAGGCGGGGCCTGAGGGG + Exonic
1006845306 6:37057371-37057393 AGCGGAAGACGGGGTCAGAGAGG + Intergenic
1007682755 6:43645546-43645568 AGGCTAGGGCGGAGCCTGAGAGG + Intronic
1008609382 6:53171907-53171929 AGCCGAAGGCTAGTCCTGTGTGG - Intergenic
1013598867 6:111685502-111685524 AGCCAAAGGAGGGGGCTCAGTGG - Intronic
1015062059 6:128978161-128978183 AGTCAAAGGCAGGGTCTGAGAGG + Intronic
1015303052 6:131675985-131676007 AGCAGAAGGGGAGGTCTGAGAGG - Intronic
1015920598 6:138262862-138262884 AGCTGAAGGATGGGGCTGAGTGG + Exonic
1017515467 6:155152360-155152382 AGGGGCAGGCAGGGCCTGAGAGG - Intronic
1017688785 6:156942478-156942500 AGCAGAAGGGGGAGCCAGAGTGG + Intronic
1018915274 6:168129092-168129114 AGGCCTAGGCGGGGCCGGAGAGG - Intergenic
1019528986 7:1494355-1494377 AGCCCCAGGCGGGGCTGGAGGGG + Intronic
1020431518 7:8120879-8120901 AGCCGAAGCCCGGGGCTGGGAGG + Intronic
1021626251 7:22595767-22595789 AGGAGAAGAGGGGGCCTGAGAGG + Intronic
1024048163 7:45599404-45599426 AGCAGAAGGCGGTGACTGAGGGG - Intronic
1024252779 7:47519121-47519143 AGCAGCAGGCGGGGCCTCAGTGG - Intronic
1026045287 7:66902545-66902567 AGCTGAAGGCAGGGCCTGGAAGG - Intergenic
1026045566 7:66903677-66903699 AGCCAAAGGCAGGGCCTGAAAGG - Intergenic
1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG + Intergenic
1027202511 7:76072660-76072682 AGCCGAAGGTGGGGCCTGAGAGG + Intergenic
1027202821 7:76073841-76073863 AGCCGAAGGCGGGGCCTGGGAGG + Intergenic
1027684335 7:81264082-81264104 AGCCCAAGCCGAGGTCTGAGGGG + Intergenic
1029123029 7:98281294-98281316 GGGGGAGGGCGGGGCCTGAGAGG - Intronic
1029608767 7:101615449-101615471 AGCGGCAGGCGGGGCCTCTGGGG - Intronic
1029708287 7:102286726-102286748 GGCCGGGGGCGGGGCCTGAGCGG + Intronic
1029715056 7:102321268-102321290 AGGCGACGGCAGGGCGTGAGTGG - Intronic
1034225013 7:149475122-149475144 ACCCGAGGACGGGGCCCGAGGGG - Exonic
1034401419 7:150864050-150864072 AGTAGAAGCCGGGGCCTCAGGGG - Intergenic
1035579160 8:729134-729156 TGCCGCAGCCAGGGCCTGAGGGG + Intronic
1038566334 8:28622694-28622716 AGCCGAGGGCGGGGCCTCAGGGG + Intronic
1039887710 8:41664741-41664763 CGCCGGAGGCCGGGGCTGAGGGG - Intronic
1039936873 8:42052529-42052551 GCCCGAGGGCGGGGCCTGGGGGG + Intergenic
1042281873 8:67064351-67064373 AGCGGAGGGCTGGGCCTGAGGGG + Exonic
1044928861 8:97233019-97233041 AGACAAAGGCGATGCCTGAGAGG + Intergenic
1045411850 8:101927842-101927864 AGCCAAAGTCAGGGCCTGGGTGG + Intronic
1048227608 8:132603849-132603871 TGCCAAAGGCGGGGGCGGAGTGG + Intronic
1049510209 8:143023398-143023420 AGCGGGAGGAGGGGCCTGATCGG + Intronic
1049548697 8:143246590-143246612 ACACGAGGGCGGAGCCTGAGGGG + Intergenic
1049614290 8:143569350-143569372 AGACGGGGGCGGGGCCTGGGAGG + Intronic
1049673141 8:143878498-143878520 AGACGGGGGCGGGGCCTGTGGGG - Intergenic
1049703043 8:144023677-144023699 ATCCCAAGGGGGGTCCTGAGGGG - Intronic
1049703277 8:144024487-144024509 ATCCCAAGGGGGGTCCTGAGGGG - Intronic
1049792346 8:144477933-144477955 AGCCGGGGGCGGAGCCTGGGAGG - Intergenic
1049798377 8:144506660-144506682 AGGCGGGGGCGGGGCCTGCGGGG + Intronic
1053397412 9:37787139-37787161 ACCCGAAGGCGGTGGCTGGGCGG + Intronic
1058481686 9:105402275-105402297 AGCCTGAGCCGGGGCCTAAGAGG + Intronic
1061053195 9:128207938-128207960 AGCCGAAGGAGCAGCCTGGGAGG + Intronic
1061845787 9:133387285-133387307 AGCTGAAGGTGGGGCAGGAGGGG + Intronic
1061878036 9:133554644-133554666 GGCCGGCGGCGGGGCCTGCGAGG + Exonic
1062046531 9:134426991-134427013 AGCCGTAGGAGGGGCAGGAGTGG + Intronic
1062309102 9:135926437-135926459 AGCCTAAGGAGGGGCCTGCAGGG - Intergenic
1062375856 9:136261643-136261665 AGCCAATGGCCGAGCCTGAGTGG + Intergenic
1062518466 9:136947537-136947559 GGCCGCAGGCAGGGCCTGAGAGG - Intronic
1062579217 9:137222125-137222147 AGGCGATGGCGGGGCCCGGGCGG + Intergenic
1203771056 EBV:50399-50421 AGCCGACGGCGGGGCCGCGGTGG + Intergenic
1189224693 X:39403004-39403026 AACCTTAGGCCGGGCCTGAGGGG - Intergenic
1196765152 X:119236226-119236248 GGGAGGAGGCGGGGCCTGAGGGG - Intronic
1197645522 X:129012576-129012598 AGCAGAAGGCTGGGCCTGTGGGG + Intergenic
1198205326 X:134460103-134460125 GGCCGGGGGCGGGGCCTGCGGGG + Intergenic
1200310379 X:155071409-155071431 CGCCGAAGGCCAGGCCTGGGCGG + Intronic
1202195606 Y:22296278-22296300 AGCCCAGGGCTGGGGCTGAGAGG + Intergenic