ID: 1027212354

View in Genome Browser
Species Human (GRCh38)
Location 7:76160763-76160785
Sequence TTAACGATTTATTGGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027212354_1027212358 11 Left 1027212354 7:76160763-76160785 CCAACCAACCAATAAATCGTTAA No data
Right 1027212358 7:76160797-76160819 TTACCATGTATTTATATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027212354 Original CRISPR TTAACGATTTATTGGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr