ID: 1027216266

View in Genome Browser
Species Human (GRCh38)
Location 7:76185787-76185809
Sequence CCTTCCCCCAACACAGAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027216266_1027216272 11 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216272 7:76185821-76185843 GCCTGGGTGTGTATGTGTCGGGG No data
1027216266_1027216276 17 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216276 7:76185827-76185849 GTGTGTATGTGTCGGGGGCTGGG No data
1027216266_1027216268 -6 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216268 7:76185804-76185826 GGAAGGCAGTGACATGTGCCTGG No data
1027216266_1027216271 10 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216271 7:76185820-76185842 TGCCTGGGTGTGTATGTGTCGGG No data
1027216266_1027216270 9 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216270 7:76185819-76185841 GTGCCTGGGTGTGTATGTGTCGG No data
1027216266_1027216277 22 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216277 7:76185832-76185854 TATGTGTCGGGGGCTGGGTACGG No data
1027216266_1027216274 12 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216274 7:76185822-76185844 CCTGGGTGTGTATGTGTCGGGGG No data
1027216266_1027216275 16 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216275 7:76185826-76185848 GGTGTGTATGTGTCGGGGGCTGG No data
1027216266_1027216269 -5 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216269 7:76185805-76185827 GAAGGCAGTGACATGTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027216266 Original CRISPR CCTTCCCCCAACACAGAATC AGG (reversed) Intergenic
No off target data available for this crispr