ID: 1027216272

View in Genome Browser
Species Human (GRCh38)
Location 7:76185821-76185843
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027216260_1027216272 28 Left 1027216260 7:76185770-76185792 CCCTTCATGGGCTGGGGCCTGAT No data
Right 1027216272 7:76185821-76185843 GCCTGGGTGTGTATGTGTCGGGG No data
1027216261_1027216272 27 Left 1027216261 7:76185771-76185793 CCTTCATGGGCTGGGGCCTGATT No data
Right 1027216272 7:76185821-76185843 GCCTGGGTGTGTATGTGTCGGGG No data
1027216266_1027216272 11 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216272 7:76185821-76185843 GCCTGGGTGTGTATGTGTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027216272 Original CRISPR GCCTGGGTGTGTATGTGTCG GGG Intergenic
No off target data available for this crispr