ID: 1027216275

View in Genome Browser
Species Human (GRCh38)
Location 7:76185826-76185848
Sequence GGTGTGTATGTGTCGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027216266_1027216275 16 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216275 7:76185826-76185848 GGTGTGTATGTGTCGGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027216275 Original CRISPR GGTGTGTATGTGTCGGGGGC TGG Intergenic
No off target data available for this crispr