ID: 1027216276

View in Genome Browser
Species Human (GRCh38)
Location 7:76185827-76185849
Sequence GTGTGTATGTGTCGGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027216266_1027216276 17 Left 1027216266 7:76185787-76185809 CCTGATTCTGTGTTGGGGGAAGG No data
Right 1027216276 7:76185827-76185849 GTGTGTATGTGTCGGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027216276 Original CRISPR GTGTGTATGTGTCGGGGGCT GGG Intergenic
No off target data available for this crispr