ID: 1027219272

View in Genome Browser
Species Human (GRCh38)
Location 7:76203630-76203652
Sequence CATTGTGCCCAGCATGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 409}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027219272_1027219275 18 Left 1027219272 7:76203630-76203652 CCAGCTCCATGCTGGGCACAATG 0: 1
1: 0
2: 4
3: 53
4: 409
Right 1027219275 7:76203671-76203693 ATCCTCACAGAAGCTTCATGAGG 0: 1
1: 0
2: 6
3: 62
4: 461
1027219272_1027219277 22 Left 1027219272 7:76203630-76203652 CCAGCTCCATGCTGGGCACAATG 0: 1
1: 0
2: 4
3: 53
4: 409
Right 1027219277 7:76203675-76203697 TCACAGAAGCTTCATGAGGAAGG 0: 1
1: 0
2: 2
3: 41
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027219272 Original CRISPR CATTGTGCCCAGCATGGAGC TGG (reversed) Intronic
900707475 1:4089652-4089674 CCTGGTGGGCAGCATGGAGCCGG + Intergenic
901839805 1:11946978-11947000 CACCGTGCCCAGCAGAGAGCTGG - Intronic
902244176 1:15108546-15108568 CAGTGTGCCCAGCACGTAGTGGG + Intronic
902936198 1:19766600-19766622 TAGAGTGCCCAGCATGGAGCTGG - Intronic
903356257 1:22749646-22749668 TATTGGGCCCAGGATGGAGAGGG + Intronic
903603288 1:24557167-24557189 CACGGTGCCCAGCATGCAGTAGG + Intronic
903788606 1:25877198-25877220 AAAGGAGCCCAGCATGGAGCAGG - Intergenic
903833023 1:26185948-26185970 CATAGTGCCCAGCCTAGAGCTGG - Intronic
903930122 1:26857060-26857082 CACTCTGGCCGGCATGGAGCGGG - Exonic
903988484 1:27247343-27247365 CACTGTGCCCAGCCTTGTGCAGG + Intronic
904008088 1:27374221-27374243 CCGGGTGCCCAGCCTGGAGCTGG + Intronic
904622453 1:31783558-31783580 CCTGGTACCCAGCATGGAGCTGG + Intergenic
904828143 1:33288997-33289019 CATGGCACCCAGCATGGGGCTGG - Intronic
905384710 1:37594341-37594363 CATGGTGCCTTGCATGGAGCAGG - Intronic
906728995 1:48064977-48064999 CACTGTGCCTAGCATGTAGTAGG - Intergenic
907566826 1:55443245-55443267 CACAGTGCCCTGCATGCAGCAGG + Intergenic
907579023 1:55555355-55555377 CAGAGTGCCTAGCAGGGAGCTGG - Intergenic
907682909 1:56580488-56580510 TATAGTGCCTAGCATGGACCTGG + Intronic
908413951 1:63894199-63894221 CATTCTGGGCAGGATGGAGCAGG + Intronic
909502824 1:76354236-76354258 CACAGGGCCCAGCCTGGAGCTGG - Intronic
909601437 1:77465529-77465551 CATTCAGCCCAGTATGCAGCAGG - Intronic
909684676 1:78334040-78334062 CTTTGAGTCCAGCATGGACCAGG + Intronic
910583295 1:88851746-88851768 CATTCTGCTGACCATGGAGCAGG - Intergenic
912794769 1:112686107-112686129 CTTTCTGCCCAGCATTGATCTGG + Intronic
913010757 1:114681304-114681326 CACTGTGCCCAGCCTGGAAACGG - Intronic
913967874 1:143392149-143392171 CATGGTGCCCTGCAGGGAGTGGG - Intergenic
913968598 1:143396982-143397004 CATTTTGCCCAGGATGAAGCTGG + Intergenic
914062254 1:144217739-144217761 CATGGTGCCCTGCAGGGAGTGGG - Intergenic
914062977 1:144222581-144222603 CATTTTGCCCAGGATGAAGCTGG + Intergenic
914116173 1:144743773-144743795 CATTTTGCCCAGGATGAAGCTGG - Intergenic
914116896 1:144748615-144748637 CATGGTGCCCTGCAGGGAGTGGG + Intergenic
914195421 1:145445861-145445883 CATCGTGCCCAGCAAGTACCTGG + Intergenic
914490832 1:148149209-148149231 CACGGTGCCCACCATGGACCTGG + Intronic
915068573 1:153246437-153246459 AATTGTGCCCAGTAGGGAGCAGG - Intergenic
916168489 1:161983713-161983735 CATTGTCCCAGGCATAGAGCAGG + Exonic
918083438 1:181224830-181224852 CATTGTATCCAGCATTGGGCTGG - Intergenic
920492849 1:206431274-206431296 CATGGTACCCAGCATTGATCAGG - Intronic
921130875 1:212218603-212218625 CAATGTGCTCAGCATGGAATAGG + Intergenic
921167501 1:212517432-212517454 CACAGTGCCCAGCAGAGAGCAGG - Intergenic
922234836 1:223714763-223714785 CATTGTGCCCAGCATATAGTAGG - Intronic
922742012 1:228019256-228019278 CACTATGACCAGCATGGAGCCGG - Intronic
923139849 1:231151887-231151909 CTTTGAGCCCTGGATGGAGCTGG + Intergenic
924710527 1:246527195-246527217 CATCGTGCCCTGCAGGGGGCTGG - Intergenic
1062871687 10:910051-910073 AATTCTGCTCAGCATGGATCTGG - Intronic
1063065031 10:2599739-2599761 AAGGGTGCCCAGCAGGGAGCGGG + Intergenic
1063389599 10:5640648-5640670 CGTTGTGCCCAGCATTGCCCGGG - Exonic
1064297232 10:14089459-14089481 CCCTGTGCCCAGCATGCTGCGGG - Intronic
1065837827 10:29675209-29675231 CATTGTGCCCAGCTGAGGGCTGG - Intronic
1066299996 10:34088121-34088143 CACCGTGCCCAGCCTGGTGCTGG - Intergenic
1068778315 10:60891634-60891656 CACTGTGCCCAGCCTAGAGGAGG + Intronic
1069226148 10:65947465-65947487 CCTAGTGTCCAGCATGTAGCAGG - Intronic
1070243690 10:74709701-74709723 CACTGTGCCCAGCCTGTGGCTGG - Intergenic
1070365685 10:75734634-75734656 CATTGTGCCTAGCAAAGAGCAGG - Intronic
1070368050 10:75755327-75755349 CATTGTGCCTAGCACATAGCAGG + Intronic
1071424443 10:85533989-85534011 CATGGTGCCCAACAAGGTGCTGG - Intergenic
1072621960 10:97085795-97085817 CTTTATGCCTAGCATGGAGGTGG + Intronic
1072730612 10:97843623-97843645 CTCCGTGCCAAGCATGGAGCTGG - Intergenic
1072914264 10:99527431-99527453 CATTGTGCCCTGCCTGGTACTGG - Intergenic
1073568676 10:104557488-104557510 CAATCTGCCCAGCATGTAACCGG + Intergenic
1074182003 10:111073889-111073911 CATTGTGCCTAGCATGTGGTTGG + Intergenic
1074456470 10:113600008-113600030 CATTGTGCCCAGCAAGTGCCTGG + Intronic
1075573120 10:123559399-123559421 GATTGTGCCCAGCCCCGAGCGGG - Intergenic
1075632954 10:124012128-124012150 CATTGTGCACAGTATGGTGAGGG - Intronic
1076888478 10:133273136-133273158 CATTGTCTGCAGCCTGGAGCAGG - Intronic
1077481098 11:2815068-2815090 CATGGTGCTCAGCACGCAGCAGG - Intronic
1078399449 11:11011101-11011123 CTCTGTGCCCAGCCTGGAGAGGG + Intergenic
1078575477 11:12498322-12498344 CACTGTGCCCAGCCTAGAACAGG + Intronic
1078924696 11:15864091-15864113 CATAGTGCCTTGCAGGGAGCTGG + Intergenic
1079373912 11:19874866-19874888 CATTGTGCCCAGTCTGCAACTGG - Intronic
1080024177 11:27596482-27596504 CAGTGTACCCACCATGGATCAGG + Intergenic
1081492413 11:43578848-43578870 CATTGTGCCAAGCAATGAGAAGG - Intronic
1081535753 11:43995134-43995156 CACCGTGCCCAGCATGCAGTAGG - Intergenic
1081834862 11:46144938-46144960 CCCTGTGCCCAGCATGCAACAGG - Intergenic
1082769985 11:57200460-57200482 CACCGTGCCCAGCATAGGGCTGG + Intergenic
1084028705 11:66468116-66468138 CACTCTGCCCAGAATGGTGCTGG + Exonic
1084154533 11:67306309-67306331 CACTGTGCCCAGCAAGAAGGAGG - Intronic
1084875459 11:72129064-72129086 CAGTGTGGCCAGCAGTGAGCTGG - Intronic
1085337359 11:75706388-75706410 CTTGGTGCCCAGCGTGGGGCGGG - Intergenic
1085584581 11:77689873-77689895 CACTGTGCCCAGCCTGGAGAAGG - Intronic
1085678817 11:78551560-78551582 CACCGCGCCCAGCCTGGAGCAGG - Intronic
1087106344 11:94412154-94412176 CATGGTGCCTGGCATAGAGCAGG - Intergenic
1087755233 11:102047811-102047833 GATTCTGCCCAGCATGGACCTGG - Exonic
1089260020 11:117217922-117217944 CATGGTGGCCAGCATGAACCAGG - Intronic
1089618348 11:119707881-119707903 CAATGTGTCAAGCATGGTGCTGG + Intronic
1089697951 11:120227381-120227403 CTGTGTGCCCTGCCTGGAGCAGG - Intronic
1089750457 11:120647892-120647914 GCCAGTGCCCAGCATGGAGCTGG + Intronic
1090225020 11:125064520-125064542 CATTTTGCCCAGGATTGAGAGGG - Intronic
1090434126 11:126672678-126672700 CTTGGTTCCCAGCATGGAGCTGG + Intronic
1090650516 11:128802092-128802114 CATAGTGCCCAGCACAGAGGTGG - Intronic
1094590331 12:31813668-31813690 CACTGTGCCCGGCCTGGAGAGGG - Intergenic
1095477470 12:42600529-42600551 CATTGTGCTCAGCATACAGTAGG - Intergenic
1096072246 12:48781891-48781913 CCTGGTGCCCAGCATGGGGAAGG + Intronic
1096659703 12:53116573-53116595 CACTGTGCTCAGCCTGCAGCTGG - Intronic
1097158031 12:57026890-57026912 CACTGTGCCCATCATGTAGATGG - Intronic
1097720681 12:63017100-63017122 CATTTTGCCCAGCATACAGTAGG - Intergenic
1098529389 12:71523352-71523374 CATAGTACCCAGCAGGGGGCTGG + Intronic
1098794447 12:74870735-74870757 CATAGTGTCCAGCATGTAGTAGG - Intergenic
1099810629 12:87578058-87578080 CAGGGTGCCAAGGATGGAGCTGG + Intergenic
1100515962 12:95328002-95328024 CACTGTGCCCAGCCTAGAGATGG - Intergenic
1100633874 12:96415544-96415566 CATTGTGCCCAGCCTAAAGTGGG + Intergenic
1100878803 12:98993455-98993477 CACTGTGCCCAGCCTGTAGTTGG + Intronic
1102014542 12:109639074-109639096 TATGGTGCCCAGCACTGAGCTGG - Intergenic
1102663316 12:114548380-114548402 AATGGTGCCTGGCATGGAGCAGG - Intergenic
1102810524 12:115820272-115820294 CATGGTGCCCAGCATACAGAAGG - Intergenic
1102886980 12:116529725-116529747 CACAGTGCCCAGCCTGAAGCAGG + Intergenic
1103680870 12:122692587-122692609 CACTGTGCCCGGCCTGGATCTGG + Intergenic
1104002707 12:124870354-124870376 CATAGTGCCCAGCACAGAGTAGG - Intronic
1104558306 12:129821954-129821976 CATGGTGCCCAGCATACAGCAGG - Intronic
1104615517 12:130264997-130265019 CAGTGTGCCCAGCAGAGAGTAGG + Intergenic
1104730009 12:131099868-131099890 CATTGTGCCTGGCATGATGCTGG + Intronic
1109072188 13:57784163-57784185 CACTGTGCCCAGCCTGGTCCTGG + Intergenic
1110543830 13:76734786-76734808 CACTGTGCCCAGCCTGAAGTAGG + Intergenic
1110645432 13:77877844-77877866 CACTGTGCCCAGCATTGTGATGG + Intergenic
1117595184 14:57320028-57320050 CATTCTACCCAGCATGGGGGTGG + Intergenic
1118058169 14:62104869-62104891 TAATGTGCCTAGCATAGAGCCGG + Exonic
1118302378 14:64627068-64627090 TATTGTGCCCAGCATATAGTAGG - Intergenic
1119593621 14:75913524-75913546 CATAGTGCCCAGCCTGTAGTAGG + Intronic
1120929538 14:89834931-89834953 CATTGTGACCAGAATGAAGCGGG + Intronic
1121351255 14:93174888-93174910 CACTGTGCCCGGCCTGAAGCTGG + Intergenic
1121493460 14:94376377-94376399 CCCTGTGCCCAGTGTGGAGCAGG - Intergenic
1121952679 14:98185328-98185350 CTCTGTGCCCAGCACGGTGCTGG + Intergenic
1122195312 14:100080402-100080424 CCATGAGCCCAGCATGGGGCAGG - Intronic
1122324626 14:100874960-100874982 CTTTGTGCCCAGGGTGGAGGGGG + Intergenic
1122556203 14:102581748-102581770 CACTGTCCCCACCATGGGGCAGG - Intergenic
1122828642 14:104384616-104384638 CCATGTGCCTAGCCTGGAGCTGG - Intergenic
1122841296 14:104465033-104465055 CATGGTCCCCAGCATGGAAGGGG - Intergenic
1122930152 14:104929435-104929457 AGTGGTGCCCAGCATGGTGCAGG - Intronic
1125788289 15:42342159-42342181 CATGGTGCCCGGCATGCAGTAGG + Intronic
1126177046 15:45745594-45745616 CCCTGTGCCCAGCATGTGGCAGG - Intergenic
1127599892 15:60524778-60524800 CATGGTGCCTAGTAGGGAGCAGG - Intronic
1128069729 15:64787361-64787383 CTTTGTGCCCAGCACACAGCTGG - Intergenic
1129712847 15:77829527-77829549 CATCGTGCCCAGCATACAGAAGG - Intergenic
1130069927 15:80638452-80638474 CATTGTGCCCAGCCTGCTCCAGG - Intergenic
1130270977 15:82446813-82446835 CATTGTACCCTGGATGCAGCAGG + Intergenic
1130374132 15:83312930-83312952 CAGTGTGTCCAGCATGTTGCAGG + Intergenic
1130463317 15:84174136-84174158 CATTGTACCCTGGATGCAGCAGG + Exonic
1130489356 15:84420652-84420674 CATTGTACCCTGGATGCAGCAGG - Intergenic
1130500948 15:84499414-84499436 CATTGTACCCTGGATGCAGCAGG - Intergenic
1130508455 15:84569504-84569526 CATTGTACCCTGGATGCAGCAGG - Intergenic
1131164340 15:90131431-90131453 CATTTTGCCCAGAACAGAGCAGG + Intergenic
1131400850 15:92124546-92124568 CATGGTACCCAGCACGGAGTGGG - Intronic
1131866221 15:96713468-96713490 CATAGTGCCCAGCACTGAGTAGG - Intergenic
1131866287 15:96714200-96714222 CATAGTGCCTGGCACGGAGCAGG + Intergenic
1132520297 16:384162-384184 GCTTGGGCCCAGCCTGGAGCAGG - Intronic
1133358826 16:5157396-5157418 CATCGTGCCCAGCCTGGATGAGG - Intergenic
1133743461 16:8669332-8669354 CACAGTGCCCAGCAGGGACCAGG + Intergenic
1133896174 16:9931380-9931402 CATGGTGCCAGGCATGGAGAAGG - Intronic
1134095441 16:11415584-11415606 CCTTGTGCCCTGCATGTAGTAGG - Intronic
1134755936 16:16667397-16667419 CATAGTGCCCAGCATACAACAGG - Intergenic
1134990132 16:18691767-18691789 CATAGTGCCCAGCATACAACAGG + Intergenic
1135055802 16:19231280-19231302 CACTGTGCCCAGCATACAGAGGG - Intronic
1135233934 16:20738411-20738433 TGTTGTGCCCAGCATGGTTCTGG - Intronic
1135270226 16:21062974-21062996 CATTGCACCCAGCTTGGAGATGG + Intronic
1135355825 16:21768248-21768270 GATTGTGCACACCAGGGAGCAGG - Intergenic
1135454315 16:22584386-22584408 GATTGTGCACACCAGGGAGCAGG - Intergenic
1135527300 16:23223608-23223630 CATTGTGCCCAGCTGCAAGCTGG + Intergenic
1136276537 16:29182299-29182321 GTGTGTGTCCAGCATGGAGCAGG - Intergenic
1136925017 16:34363677-34363699 CACTGTGCCCAGCCTTGAGCAGG + Intergenic
1136979556 16:35048129-35048151 CACTGTGCCCAGCCTTGAGCAGG - Intergenic
1137344600 16:47644382-47644404 CACTGTGCCTAGTATGTAGCTGG - Intronic
1137394129 16:48105053-48105075 CAGTGTGCCAGGCATGGTGCTGG - Intronic
1137459960 16:48651322-48651344 CATTCTGCCCAGGATGTATCAGG + Intergenic
1137582751 16:49643935-49643957 CTTGGTGACCAGCATGGAGCAGG + Intronic
1137769460 16:51004426-51004448 CACTGTGCCCGGCCTGAAGCAGG + Intergenic
1138839491 16:60482469-60482491 CATTCTGAACAGCTTGGAGCAGG + Intergenic
1139710039 16:68769175-68769197 AATTCTGCCCAGCATAGAGGAGG + Intronic
1140406466 16:74714448-74714470 TATTGTCCCCAGCATGAAGCTGG + Intronic
1140687521 16:77447905-77447927 CATTCTCTCCACCATGGAGCTGG + Intergenic
1140716337 16:77728766-77728788 CCTGGTGCCCAGCAAAGAGCTGG + Intronic
1141513717 16:84529068-84529090 CCTGGTGCCCAGCAAGGAGTAGG - Intronic
1141586244 16:85035298-85035320 CCCAGTGCTCAGCATGGAGCAGG + Intronic
1141699084 16:85634242-85634264 CCGTGTGCTCTGCATGGAGCAGG + Intronic
1143520938 17:7443928-7443950 CCTTTTACCCAGGATGGAGCTGG + Exonic
1143768736 17:9154296-9154318 CATGGTGCCCAGAATGCACCAGG + Intronic
1145257901 17:21337632-21337654 CCCTGTGGCCAGCAGGGAGCTGG - Intergenic
1145318733 17:21750374-21750396 CCCTGTGGCCAGCAGGGAGCTGG + Intergenic
1146381960 17:32337170-32337192 CATTGTGCCCAGCCTACAGGTGG - Intronic
1147431139 17:40371515-40371537 TCTTGTGCCCAGGAGGGAGCAGG + Intergenic
1147672671 17:42185571-42185593 CCTTGGGCCCAGCCTGGAGACGG - Intergenic
1147674899 17:42198406-42198428 CACCATGCCCAGCCTGGAGCTGG - Intergenic
1148202028 17:45755805-45755827 CACGCTGCCCAGCATGGAGGAGG - Intergenic
1149285831 17:55163594-55163616 CATTTTGCCTGGCATGTAGCAGG - Exonic
1149497537 17:57129137-57129159 CACTGTGCCCAGCTGGGAACAGG - Intergenic
1149604321 17:57914131-57914153 CTCAGTGCCCAGCATAGAGCAGG + Intronic
1150866476 17:68855922-68855944 CACTGTGCCCAGCCTAGAGTTGG - Intergenic
1151219404 17:72601171-72601193 CATTCTTCCCAGCCTGGTGCAGG + Intergenic
1151290430 17:73146039-73146061 CATTTTGCCCTGAATGGAGACGG - Intergenic
1151370513 17:73644086-73644108 CATGGTGACCAGCCTGGAGAGGG + Exonic
1152614571 17:81331831-81331853 CAATATGCCCAGCCTGGCGCAGG + Intergenic
1152803289 17:82342091-82342113 CCTTGTACCCAGCACGGCGCCGG + Intergenic
1153534170 18:6083031-6083053 CTTTGTGCCCAAGATGGGGCAGG - Intronic
1154380965 18:13849484-13849506 CACTGTGCCCAGCCAGGAGAAGG - Intergenic
1155042519 18:22076496-22076518 AAAGGTGCCCAGCATGGAGGAGG - Intergenic
1155203346 18:23536541-23536563 CCCTGTGCTCAGAATGGAGCAGG + Intronic
1156504222 18:37578619-37578641 CACGGTGCCAAGCATGGTGCTGG - Intergenic
1156584768 18:38420033-38420055 CATGGTGCCTAGCAGGCAGCAGG - Intergenic
1156915390 18:42460450-42460472 CATTGTGCCCTTCATGGTACTGG + Intergenic
1157081067 18:44525721-44525743 CTAAGGGCCCAGCATGGAGCAGG + Intergenic
1157408219 18:47441455-47441477 CTTTGTGCTCAGCATAGAGCAGG + Intergenic
1158533891 18:58290137-58290159 CTTTGTGCCAAGCATCGAGTGGG - Intronic
1158658426 18:59362023-59362045 CATTGGGCCCTGCACAGAGCTGG + Intergenic
1158841464 18:61392577-61392599 CCTTGTGCTCAGCATGGAGAGGG - Intronic
1159088271 18:63818743-63818765 GATTCTGCCCAGGTTGGAGCTGG + Intergenic
1159462693 18:68740901-68740923 CAGTTTGCTCAGCATGGAGAAGG + Intronic
1160594303 18:79963725-79963747 CACGGTGCCCAGCGAGGAGCAGG - Intergenic
1160607673 18:80064657-80064679 CACGGTGCCCAGCAAGAAGCAGG - Intronic
1160732677 19:648371-648393 CATCGTGCCCTGGCTGGAGCAGG - Exonic
1161063192 19:2225543-2225565 CATCGTGTCCCGCATGGTGCTGG + Intronic
1161629683 19:5346698-5346720 CATGGAGCCCAGCACAGAGCAGG - Intergenic
1162052886 19:8045709-8045731 CTATGTGCCCAGCACTGAGCTGG - Intronic
1162301249 19:9846381-9846403 CATAGTGCCCGGCACCGAGCAGG - Intronic
1162461336 19:10815953-10815975 CAATGAGCCCAGCACAGAGCAGG - Intronic
1163440547 19:17320531-17320553 CATGGTGCCAAGGATGGAGCGGG + Exonic
1163816143 19:19465662-19465684 CAGTGTGCCCAGGTTGGGGCTGG + Intronic
1164566544 19:29329853-29329875 CACAATGCCCAGCATGTAGCCGG - Intergenic
1165090903 19:33387994-33388016 CATGGTGCTCACCGTGGAGCCGG - Exonic
1165246883 19:34503040-34503062 CATGGTGACCGGGATGGAGCAGG - Exonic
1165394151 19:35555166-35555188 CATTGTGACAGGCGTGGAGCAGG - Exonic
1165406424 19:35633839-35633861 CATTGGGCCCAGCCTGCCGCTGG + Exonic
1165485258 19:36091606-36091628 CATCATGCCCAGCTTAGAGCTGG - Intronic
1165775199 19:38400261-38400283 CACTGTGCCTAGCCAGGAGCTGG + Intergenic
1165856412 19:38881287-38881309 CATTCTCCCCAGGATGGATCTGG + Intronic
1166407237 19:42529611-42529633 CATCCTGCACCGCATGGAGCTGG - Intronic
1166785051 19:45362675-45362697 CTGTGTCCCCAGCATGAAGCAGG + Intronic
1166859474 19:45801470-45801492 CACTGTGCCCAACCTGGAGCTGG - Intronic
1167450794 19:49567575-49567597 CATTTTCCACAGCATGGTGCAGG - Intronic
1202701662 1_KI270712v1_random:169617-169639 CATGGTGCCCTGCAGGGAGTGGG - Intergenic
1202702387 1_KI270712v1_random:174452-174474 CATTTTGCCCAGGATGAAGCTGG + Intergenic
924968509 2:100953-100975 CATTCTGACCAGGATGGAGTTGG - Intergenic
925987671 2:9229557-9229579 GGTTGTGGCCAGCATTGAGCTGG + Intronic
926292089 2:11539337-11539359 CATTGTGCCCAGCCAATAGCTGG + Intronic
929715011 2:44301450-44301472 CACTGTGCCCGGCCTGGAACTGG - Intronic
929881614 2:45841877-45841899 CACTGTCCCCAGCAAAGAGCAGG - Intronic
930086110 2:47498417-47498439 CACCGTGCCCAGCCTGGAGGGGG - Intronic
930251686 2:49041856-49041878 CATTGTGCCCAGCCTGGTTAAGG - Intronic
931257253 2:60584454-60584476 GAAAGTGCCCAGCATGGTGCAGG - Intergenic
931710855 2:64988704-64988726 CATGGTGCCCAGCAAGGCCCCGG - Intronic
932435158 2:71699069-71699091 CTGTGTGCCCAGCCTGGGGCTGG - Intergenic
934172577 2:89553064-89553086 CATGGTGCCCTGCAGGGAGTGGG - Intergenic
934173299 2:89557906-89557928 CATTTTGCCCAGGATGAAGCTGG + Intergenic
934282890 2:91627416-91627438 CATGGTGCCCTGCAGGGAGTGGG - Intergenic
934283614 2:91632259-91632281 CATTTTGCCCAGGATGAAGCTGG + Intergenic
934549347 2:95245555-95245577 CACCGTGCCCAGCCTGGAGCTGG + Intronic
935210640 2:100937075-100937097 CAGTGTGCCCAGCATAGAGTAGG + Intronic
936038886 2:109134096-109134118 CAAAGTGCCCAGCATGCAGCAGG - Intronic
936093076 2:109513116-109513138 CATTGTGCCAGGGAAGGAGCTGG - Intergenic
937390056 2:121478310-121478332 CACTGTGCCCAGCCTGTAGGTGG - Intronic
937695285 2:124802112-124802134 CATTGTGCACAACCTGGAGGCGG - Intronic
937861634 2:126715896-126715918 GAATGTGCCCAGCCTGAAGCAGG - Intergenic
938115795 2:128602288-128602310 TCTTGTGCCCATCCTGGAGCTGG + Intergenic
938130118 2:128707890-128707912 CTTTGAGCCAAGGATGGAGCTGG + Intergenic
939463470 2:142527593-142527615 CATGGTGCCCAGCCTGGATATGG - Intergenic
939504936 2:143033518-143033540 CAATGTGCCAAGCATTGTGCTGG - Intronic
941336794 2:164255438-164255460 CATTGTGCCAGGGAAGGAGCTGG - Intergenic
945038629 2:205726019-205726041 CATTGTCATCACCATGGAGCCGG - Exonic
946948792 2:224850011-224850033 AACTGTACCCAGCATGGTGCTGG + Intronic
947758187 2:232584318-232584340 CTTTGAGCCCATCATGAAGCTGG + Intergenic
948005406 2:234603994-234604016 CCTGGTGGCCAGCATGGAGGAGG - Intergenic
1169546425 20:6655391-6655413 CAAGGTCCCCAGCAAGGAGCTGG - Intergenic
1170645395 20:18192909-18192931 CATTGTGCCCAGCCCTGAGGTGG - Intergenic
1171448106 20:25218751-25218773 CTGGGTGCCCAGCATGCAGCGGG - Intronic
1171470170 20:25364022-25364044 CCTTGTGCTGAGAATGGAGCAGG + Intronic
1172173977 20:32961270-32961292 CCTGGTGCCCAGCAGGGAGCAGG + Intergenic
1172605126 20:36208856-36208878 CATGGAGCCCAGGGTGGAGCTGG + Intronic
1172801969 20:37582162-37582184 CCCTGTGCCCAGCATGGTGTGGG - Intergenic
1172816461 20:37691067-37691089 AATTGTGCCTAGCATTGAGTAGG + Intergenic
1172900697 20:38332513-38332535 CACTGTGCCTAGTATGGTGCTGG - Intronic
1172974396 20:38895421-38895443 CAGTGTGAACATCATGGAGCTGG + Intronic
1173379838 20:42530341-42530363 CATGGTGCCTGGCATGCAGCGGG - Intronic
1173579468 20:44137086-44137108 CATTGTGCCCAGCACATAGTAGG + Intronic
1174103947 20:48148788-48148810 CATCGTGCCCAGCACTGAGCTGG + Intergenic
1175072809 20:56348703-56348725 CATTGTGCCTGGCATTGAGTAGG + Intergenic
1175210337 20:57350383-57350405 CATTTTCCCCACCATGCAGCAGG + Intergenic
1175955780 20:62608386-62608408 CATTGTCCACGGCAAGGAGCCGG - Intergenic
1179249239 21:39658951-39658973 CACTGTGCCCAGCCAAGAGCTGG - Intronic
1179541102 21:42083694-42083716 CATTGTGCCCGGCACATAGCAGG + Intronic
1179559191 21:42202014-42202036 CACTGCGCCCTGCATGGACCAGG - Intronic
1179887163 21:44319091-44319113 CAGAGTGCCCTGCCTGGAGCTGG + Intronic
1179975848 21:44865647-44865669 CTTTGTGCCCTGCCTGCAGCGGG - Intronic
1180692248 22:17727128-17727150 CCTTGTCCCCAGCAGGGAGGTGG - Exonic
1181086589 22:20442372-20442394 CACCGTGCCCAGCAGGGAGTGGG + Exonic
1181620833 22:24090146-24090168 CATTGTGCCCTGTATGGGGAAGG + Intronic
1182660500 22:31921553-31921575 CAGTGTGCCTAGCACGTAGCAGG + Intergenic
1183475666 22:38034507-38034529 CGAAGTGCCCAGCATGGGGCGGG + Intronic
1183770932 22:39925261-39925283 CATTGTCCCCAGCCTGGGTCAGG - Intronic
1183946381 22:41328398-41328420 CCCAGTGCCCAGCATGGAGCAGG - Intronic
1184461752 22:44641666-44641688 CACAGTGCCCAGCATATAGCAGG - Intergenic
1184735464 22:46395267-46395289 CATGGAGCACAGCTTGGAGCAGG - Intronic
949930498 3:9074614-9074636 CAGTGAGCCCAGGGTGGAGCTGG + Intronic
950039793 3:9912912-9912934 CTTTGTGCCCACCCTGTAGCAGG + Intronic
950139996 3:10608868-10608890 CCTGGTGCCTAGCAGGGAGCTGG + Intronic
950866284 3:16191746-16191768 CACAGTGCCTGGCATGGAGCAGG - Intronic
951596446 3:24323546-24323568 CATTGGCCCCACCAGGGAGCTGG - Intronic
951919919 3:27843128-27843150 CATTGTGCCTAGCATGGAGTAGG + Intergenic
952866000 3:37855551-37855573 CATTGTGGCCACCAGGGGGCGGG + Intergenic
953315525 3:41923208-41923230 CACTGTGCCCAGCCTGGTTCAGG - Intronic
955372051 3:58360545-58360567 CACTGTGCCCAGCCTGGAGCTGG - Intronic
955651038 3:61194117-61194139 CTTTCTTCCCAGTATGGAGCAGG + Intronic
956589889 3:70903649-70903671 CCATGTGCCCAGCACTGAGCTGG + Intergenic
956746485 3:72314894-72314916 CCCTATGCCCAGCATGGAGTAGG - Intergenic
956884869 3:73548962-73548984 CTTTGTGCCTTGCATGGGGCAGG - Intronic
956933024 3:74067605-74067627 CATTTTGCCCAGATTGAAGCTGG + Intergenic
958450719 3:94269196-94269218 CAATGTGTCAAGCATTGAGCTGG + Intergenic
959395177 3:105828136-105828158 CATTCTAGCCAGCAGGGAGCAGG + Intronic
961219344 3:125187478-125187500 CAATGCCCCCAGCAGGGAGCTGG - Intronic
961380870 3:126495859-126495881 CAGTGTGGCCACCATGGGGCTGG + Intronic
961472583 3:127125384-127125406 CACTGTGCCCAGCCAGGAACAGG - Intergenic
961497380 3:127304510-127304532 CATTGTACCCAGGAGGGGGCAGG - Intergenic
962351895 3:134662500-134662522 CATAGGGCCCAGCATAGAGTGGG - Intronic
962747618 3:138409034-138409056 GATTCTGCCCAGCAAGGAGGAGG + Intergenic
962804065 3:138914842-138914864 CATAAGGTCCAGCATGGAGCAGG + Intergenic
963205803 3:142632885-142632907 CACCGTGCCCAGCCTAGAGCAGG + Intronic
963280724 3:143382495-143382517 TTGTGTGCCCAGCCTGGAGCAGG + Intronic
965609696 3:170531149-170531171 CATTATGCCTGGCATGGGGCAGG - Intronic
966782154 3:183593136-183593158 CACTGCGCCCAGCATCAAGCAGG - Intergenic
967007535 3:185398672-185398694 CATGGTGCCTAGCATGTAGCAGG + Intronic
967713490 3:192736712-192736734 CATTGTGCCCAGCATATAGCAGG + Intronic
968316225 3:197728038-197728060 CACTGTGCCCAGCATAGGTCAGG - Intronic
968316238 3:197728110-197728132 CACTGTGCCCAGCATAGGTCAGG - Intronic
968593371 4:1470807-1470829 CATTGGGGTCAGGATGGAGCAGG - Intergenic
968725865 4:2247590-2247612 CCTAGTGCCCAACATGGACCTGG + Exonic
969245617 4:5930831-5930853 CATGATGCCCAGCATGGGCCTGG + Intronic
969259133 4:6022601-6022623 GACTGTGCCTAGCAGGGAGCCGG + Intergenic
969435778 4:7188581-7188603 CCCAGTGCCCAGCCTGGAGCTGG + Intergenic
969746438 4:9076383-9076405 CACCGTGCCCAGCATGGATGAGG + Intergenic
969827152 4:9766716-9766738 CAGTTTGCCCAGGATGAAGCCGG + Intergenic
970403203 4:15737543-15737565 AAGTGTGCCAGGCATGGAGCTGG - Intronic
971050626 4:22857972-22857994 CAATATGCCCAGCATGTAGTAGG + Intergenic
971315578 4:25565027-25565049 CATTGTGCCGAGCACGGCCCTGG - Intergenic
971525947 4:27618845-27618867 CATTGTGCCCATCATGAATCTGG - Intergenic
972458844 4:39280368-39280390 CATTGTGCCCAGCCTGGCAATGG - Intronic
973740799 4:53917464-53917486 AATGGTGCCCAGCATGTAGTAGG + Intronic
975681256 4:76878821-76878843 CATTGTGCCTAGAATAAAGCAGG + Intergenic
979448150 4:120839188-120839210 CAATGTGGCAAGCAAGGAGCAGG + Intronic
981010304 4:139918431-139918453 CAATAAGCCCAGCAAGGAGCTGG - Intronic
981339364 4:143602935-143602957 TATTTTGCCCAGGATGGAGATGG + Intronic
981502469 4:145467115-145467137 AACTGTGCCCAGCATGCAGCAGG + Intergenic
981732919 4:147918855-147918877 CGTTGTGCCTGGCATTGAGCTGG + Intronic
981981309 4:150794260-150794282 CCTTGTGCCATGTATGGAGCTGG + Intronic
985024805 4:185730450-185730472 CATTGTGTGCAGCACTGAGCTGG + Intronic
985555690 5:556895-556917 CAGTGTCCCCACCAAGGAGCAGG + Intergenic
985761347 5:1750796-1750818 CATTGTCTCCTGCAGGGAGCAGG + Intergenic
985896547 5:2752400-2752422 CACTCCGCCCAGCATGGACCTGG + Exonic
986169940 5:5307134-5307156 CCTCATGCCCACCATGGAGCGGG + Intronic
986702722 5:10427302-10427324 CATTGTGCCCAGTGTGGAGAAGG - Intronic
987693739 5:21301672-21301694 AATTTCTCCCAGCATGGAGCTGG + Intergenic
989205337 5:38804262-38804284 CTTTCAGCCCAGCATGGAACAGG + Intergenic
989524331 5:42435886-42435908 CTTTGTGCCCAGCATGATGTTGG - Intronic
990298925 5:54431409-54431431 CACTGTGCCCAGCCTGGACTGGG - Intergenic
990646120 5:57846311-57846333 CAATGTGCCAAGCATTGAGCTGG + Intergenic
991230936 5:64331750-64331772 CAATGTGGCGAGCATGGGGCGGG - Intronic
991467154 5:66925705-66925727 CACTGTGCCTAGCATGTAACAGG + Intronic
991746523 5:69747865-69747887 AATTTCTCCCAGCATGGAGCTGG - Intergenic
991751182 5:69807376-69807398 AATTTCTCCCAGCATGGAGCTGG + Intergenic
991798123 5:70327810-70327832 AATTTCTCCCAGCATGGAGCTGG - Intergenic
991825901 5:70623179-70623201 AATTTCTCCCAGCATGGAGCTGG - Intergenic
991830471 5:70682270-70682292 AATTTCTCCCAGCATGGAGCTGG + Intergenic
991890464 5:71327132-71327154 AATTTCTCCCAGCATGGAGCTGG - Intergenic
992385126 5:76277483-76277505 CATTGTGCCCAGCCTTGGTCTGG - Intronic
992570289 5:78048410-78048432 CATTCAGCCCATGATGGAGCTGG + Intronic
992773971 5:80073670-80073692 CACTGTGCCCAGCCCGGAGAGGG + Intronic
995049132 5:107682544-107682566 CATTGTGCACAGCATGTAGTAGG + Intergenic
997010828 5:129875384-129875406 CATGATGCCCAACAGGGAGCTGG + Intergenic
997287154 5:132688299-132688321 CATTCTTCTCAGCATAGAGCAGG + Intergenic
998560388 5:143166076-143166098 CCTTGTGCCCATCACGAAGCAGG - Intronic
999493735 5:152076436-152076458 CATTATGCCAAGCATTGGGCTGG + Intergenic
999704829 5:154262679-154262701 CATTGTGCTCAGCACTAAGCTGG + Intronic
1002278544 5:178118129-178118151 CCCAGTGCCCAGCATGGAGCGGG - Intronic
1002511681 5:179723947-179723969 TATTGTGCCCAGATGGGAGCAGG + Intronic
1002836496 6:869273-869295 CAGAGTGCCCAGCGTGGAGCAGG + Intergenic
1003052534 6:2792897-2792919 CATGGTGCCCAGCATATGGCAGG - Intergenic
1003722577 6:8720485-8720507 CATTGTGCCTGGCATGTAACGGG + Intergenic
1005503607 6:26451095-26451117 CATAGAGCCCAGCATAGAGACGG + Intronic
1005557171 6:26998264-26998286 AATTTCTCCCAGCATGGAGCTGG - Intergenic
1005809070 6:29502535-29502557 CTTTGTGCCCAGGAGGGAGAGGG + Intergenic
1006471367 6:34231053-34231075 CAGTGGGCCCAGCATGGAGCCGG - Intergenic
1006844323 6:37051845-37051867 CTGTGTGCCCAGCACGGAGCTGG + Intergenic
1007078694 6:39083967-39083989 CACAGTGCCCAGCATACAGCAGG - Intronic
1010013675 6:71079553-71079575 CTTGGTGCCTAGCATGGGGCTGG + Intergenic
1010243245 6:73637275-73637297 GATAGTGCCTAGCATGGAGTAGG - Intronic
1010474275 6:76266627-76266649 GATAGTGCCTAGCATAGAGCAGG - Intergenic
1011227803 6:85127017-85127039 CAGTGTGGCCACCATGGGGCTGG + Intergenic
1011767067 6:90633446-90633468 CAGTCTGCCCAACATGTAGCAGG + Intergenic
1012652738 6:101777257-101777279 CACTCTGCCCAGCACAGAGCAGG - Intronic
1015125262 6:129747348-129747370 CACTGTGTCCAGCTTGGAGCTGG - Intergenic
1018703267 6:166444781-166444803 CACAGTGCCCAGCTTAGAGCAGG - Intronic
1019623246 7:2002788-2002810 CACTGTCCCCAGCAGGGAGCTGG - Intronic
1019702139 7:2479133-2479155 GGCAGTGCCCAGCATGGAGCTGG + Intergenic
1020259290 7:6521642-6521664 CTGTGTCCCCAGCATGGAGCTGG + Intronic
1021871128 7:25007306-25007328 CCTTGTGCTGAGCATGGTGCTGG - Intergenic
1022165225 7:27753009-27753031 CACTGTGCCCAGCCTGCATCAGG - Intronic
1022476825 7:30716446-30716468 CTTTGTGCCCTGCTTGGAGGGGG + Intronic
1022851811 7:34271021-34271043 CATTGTGCCCAAGATGTAGGAGG + Intergenic
1023098875 7:36692193-36692215 CATGGTGCCTGGCATGGAGCAGG + Intronic
1023391379 7:39714711-39714733 CTTTGTGCCCTGGCTGGAGCTGG - Intergenic
1024208337 7:47182747-47182769 CATGGTGCCCAGCATGATGATGG + Intergenic
1024504123 7:50146857-50146879 CACAGTGCCCAGCATGCAGCAGG - Intronic
1026231267 7:68486040-68486062 CACGGTGCCCAGCATGGTGTTGG - Intergenic
1026513843 7:71049742-71049764 CACAGGGCCCAGCCTGGAGCTGG - Intergenic
1027219272 7:76203630-76203652 CATTGTGCCCAGCATGGAGCTGG - Intronic
1028199546 7:87945095-87945117 CACTGTGCCTTGCATGGATCAGG + Intronic
1029597717 7:101546562-101546584 CACTGTGCCCAGCCTGGGGAAGG + Intronic
1030678143 7:112406278-112406300 CATTTCACCCAGCATGGGGCAGG - Intergenic
1031977261 7:128102053-128102075 CCTTGTGCCCAGCAGAGAGTAGG - Intergenic
1032194064 7:129779795-129779817 CTGTGCGCCCAGCCTGGAGCCGG - Intergenic
1032463819 7:132130952-132130974 CGTAGTGCTCAGCATGGAGCCGG + Intronic
1032894563 7:136236265-136236287 CATTCTGTGCAGCAAGGAGCAGG - Intergenic
1033623132 7:143080459-143080481 CACTGTGGCCAGCCAGGAGCAGG - Intergenic
1034057061 7:148046232-148046254 CATTGTGCCCAGCCAGTACCTGG + Intronic
1034275871 7:149823649-149823671 CACTGTGCCCCGCCTGCAGCAGG - Intergenic
1035862391 8:3043539-3043561 CATGGTGCCCAGCATAGAGTAGG + Intronic
1036228770 8:6982273-6982295 CCTTATGCCCTGCGTGGAGCAGG - Intergenic
1036231222 8:7001383-7001405 CCTTATGCCCTGCGTGGAGCAGG - Intronic
1036233671 8:7020482-7020504 CCTTATGCCCTGCGTGGAGCAGG - Intergenic
1037955862 8:23057956-23057978 CATTGTGCCCAGCCAAGAGATGG - Intronic
1039453259 8:37692638-37692660 CTTTGTGCCAAGCATGAAACAGG + Intergenic
1039917098 8:41868145-41868167 CATTGTACCCAGCCTGAAGCAGG + Intronic
1044121535 8:88403006-88403028 CACAGTGCCCAGCAGAGAGCAGG + Intergenic
1044543442 8:93432985-93433007 CATTGTGCTCAGTATGGATTTGG + Intergenic
1047179621 8:122574462-122574484 CACTGTGCCCAGCCAGCAGCTGG + Intergenic
1047340651 8:123977236-123977258 CACGGTGTCCAGCATAGAGCAGG + Intronic
1047768337 8:128008729-128008751 CATTGTGCCCAGCATGGTCAGGG - Intergenic
1047940430 8:129823502-129823524 CTTTGTGCCAAGGAAGGAGCTGG - Intergenic
1048139382 8:131778222-131778244 CATTGTTCAAAGCATGGAACTGG + Intergenic
1048354356 8:133641285-133641307 CTTTGTGCCCAGGACAGAGCTGG + Intergenic
1048454388 8:134564880-134564902 CACAGTGCCCAGCATGTTGCAGG - Intronic
1048708700 8:137183864-137183886 CATGGTGCCCAGCATGGTGTGGG - Intergenic
1049258923 8:141628399-141628421 GATTGTGTCCAGCATGGGGAGGG - Intergenic
1049302806 8:141880493-141880515 CATGATGCCCAGCAAGGAGGGGG - Intergenic
1049576286 8:143391410-143391432 CTGTGTGCCCAACATGGAACAGG + Intergenic
1051586214 9:18729659-18729681 CATTGTGCCAAGCATTGTGTGGG + Intronic
1051730300 9:20135066-20135088 CCATGTGCCCAGCATTGTGCTGG + Intergenic
1053518695 9:38754609-38754631 CACTGTGCCCAGCCTAGAGATGG + Intergenic
1056509889 9:87294306-87294328 CACTGTGCGTAGCATAGAGCAGG + Intergenic
1056602433 9:88056579-88056601 GTTTGTGGCCAGCATGGAGGAGG + Intergenic
1058034836 9:100239682-100239704 CACTGTGCCCAGCCTGGCACAGG - Intronic
1059970888 9:119667046-119667068 CATGGCGCCTGGCATGGAGCAGG - Intergenic
1060230730 9:121823255-121823277 CACTGCGCCCAGCCAGGAGCTGG - Intronic
1060317709 9:122528306-122528328 CACTGTGCCCAGCCGGGATCAGG - Intergenic
1061512557 9:131069906-131069928 CCTGGTGCCCGGCATAGAGCTGG - Intronic
1062041058 9:134404523-134404545 CTGAGTGCCCGGCATGGAGCTGG + Intronic
1062490382 9:136802517-136802539 CGTTGTGCCCAGCGGGGAGTGGG + Intronic
1062501216 9:136852817-136852839 CAGAGTGCCCAGCAGGGAACTGG - Intronic
1062614441 9:137389666-137389688 CAGTGAGACCAGCAAGGAGCTGG + Intronic
1062699244 9:137890489-137890511 CATCGTGCCCAGCAAGTACCTGG - Intronic
1188309135 X:28596090-28596112 CATTGTGCACAGCATATAGTAGG + Intronic
1189282920 X:39831869-39831891 CATTGTGCCCTGCCTGTAGTAGG - Intergenic
1189671776 X:43418281-43418303 CATTGTGCTTAGCATGAAACAGG - Intergenic
1190730895 X:53224880-53224902 CCTCGGGCCCACCATGGAGCCGG - Exonic
1192239756 X:69319707-69319729 TAATGTGGCCAGCATGTAGCCGG + Intergenic
1192355420 X:70398324-70398346 CATTGTGCCCAGCCAAGGGCTGG + Intronic
1192587015 X:72327147-72327169 CTTTGGGCCCAGCACTGAGCAGG + Intergenic
1194039424 X:88921444-88921466 CATTCTGAGCAGGATGGAGCAGG + Intergenic
1194534279 X:95086235-95086257 CATGGTGCCCTGCATCCAGCTGG - Intergenic
1195814421 X:108869457-108869479 CTTGGTTCCCAGGATGGAGCAGG - Intergenic
1196275068 X:113757071-113757093 CCTTGTAGCCAGCATGGAGATGG + Intergenic
1196610900 X:117713507-117713529 CACTTTGCCCAGCACTGAGCTGG - Intergenic
1197160975 X:123321581-123321603 AAATGTGTTCAGCATGGAGCGGG + Intronic
1197884506 X:131204337-131204359 CATTGTGCCCAGGATGCTGGTGG + Intergenic
1198394179 X:136206413-136206435 CATGGTGCCCACCTTGTAGCTGG - Exonic
1198437277 X:136629608-136629630 CTGTGTGCCCAGCATGCAGCTGG + Intergenic
1198699681 X:139383184-139383206 TACTGTGCCCAGCATGTAACAGG + Intergenic
1199210236 X:145199914-145199936 CATTGTGCTTAGAAGGGAGCAGG - Intergenic
1199267208 X:145842456-145842478 CGTAGTGCCCAGCATAGAGGAGG - Intergenic
1200053408 X:153446338-153446360 CATTGGCCCCAGCATGGGGGAGG - Intronic
1202371873 Y:24204476-24204498 CATTGTACCCTGGATGCAGCAGG - Intergenic
1202498912 Y:25465640-25465662 CATTGTACCCTGGATGCAGCAGG + Intergenic