ID: 1027219788

View in Genome Browser
Species Human (GRCh38)
Location 7:76206595-76206617
Sequence GGCCCCATGTCATCTAGAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027219785_1027219788 -3 Left 1027219785 7:76206575-76206597 CCTGGAGGCTCAGCCCTGTTGGC 0: 1
1: 0
2: 5
3: 25
4: 285
Right 1027219788 7:76206595-76206617 GGCCCCATGTCATCTAGAATAGG 0: 1
1: 0
2: 0
3: 4
4: 69
1027219783_1027219788 1 Left 1027219783 7:76206571-76206593 CCATCCTGGAGGCTCAGCCCTGT 0: 1
1: 0
2: 4
3: 52
4: 533
Right 1027219788 7:76206595-76206617 GGCCCCATGTCATCTAGAATAGG 0: 1
1: 0
2: 0
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027219788 Original CRISPR GGCCCCATGTCATCTAGAAT AGG Intronic
900714998 1:4138579-4138601 GGGCACATGCCATCTCGAATGGG - Intergenic
902064140 1:13670389-13670411 GGCACGATGTCATCAAGAAACGG + Intergenic
907569860 1:55473154-55473176 GTCCCCATGTCCTCAAGAAAAGG - Intergenic
907979845 1:59471001-59471023 GGCCCCATTTAACCTAGAAAAGG - Intronic
908397914 1:63743217-63743239 GGCCACAGGTCATTTAGAGTAGG + Intergenic
910668161 1:89746319-89746341 TGCCCAATGTCATCTGGAAGTGG + Intronic
915728784 1:158037974-158037996 GGCCCAGTGTCAGCTAGACTCGG + Intronic
917637941 1:176955262-176955284 GGTCCCTTGTCATCTGGAAGTGG - Intronic
919744215 1:200998847-200998869 GGTCCCATGTCATCTGGAACAGG - Intronic
1075346295 10:121684126-121684148 GGCCTCATGTCCCCTTGAATAGG - Intergenic
1075977496 10:126708304-126708326 GACCCCATATCATCTAAAAAAGG - Intergenic
1091191754 11:133701482-133701504 GGCCCCAGGTCAACAACAATGGG + Intergenic
1095578714 12:43769913-43769935 GGCCAGATGTCTTATAGAATGGG - Intronic
1097223555 12:57463893-57463915 GGCCCCATGTCATATGGACCTGG + Intronic
1100467556 12:94860631-94860653 GATCCCATGTCATCAAGAAAGGG + Intergenic
1119158253 14:72431291-72431313 GGCCCTATCTCATCAAGTATAGG - Intronic
1123954071 15:25315519-25315541 GGCCTAATCTCATCTTGAATAGG + Intergenic
1124075411 15:26439184-26439206 TGCACCAAGTCATCTAGGATAGG + Intergenic
1125932303 15:43609185-43609207 GGCACCATGTGATATGGAATGGG - Intronic
1126508242 15:49433745-49433767 GGCCACAGCTCCTCTAGAATTGG - Intronic
1128752179 15:70157655-70157677 GGCCACGTGTCAGATAGAATGGG - Intergenic
1134074536 16:11281353-11281375 GGCCCCCTGGCATCTATAACAGG - Intronic
1134837986 16:17377784-17377806 GGAACCATCTCATCTAGAAAGGG + Intronic
1143209983 17:5179029-5179051 GGCCTCCTGTCATCTGGAACTGG - Intergenic
1144906400 17:18641468-18641490 GGCCCCTTGTCATCTGGGAGGGG - Intronic
1146164472 17:30576889-30576911 GGCCTCCTGTCATCTGGAACTGG + Intergenic
1151549028 17:74810790-74810812 GGCACCATGCCATCTAGAGGAGG - Intronic
1153228333 18:2914288-2914310 GGCCCCATGTCATCTGCAGCTGG + Exonic
1153676846 18:7463543-7463565 GGACCTATCTCATTTAGAATAGG + Intergenic
1155473296 18:26212962-26212984 AGCCCCATGGCATCAAGAAGTGG - Intergenic
1160211538 18:76884602-76884624 GACCCCAGGTCATCAAGAAGTGG - Intronic
1160583394 18:79900172-79900194 GCCCCCATGGCATCCGGAATGGG + Intronic
1162001051 19:7745270-7745292 GGCCCCATCTCCTCCAGACTAGG + Intronic
934659420 2:96135264-96135286 GGCCCCATGGCATCCAGGGTGGG + Intronic
935315271 2:101827273-101827295 GCCTACATGTCATCTAGAATGGG + Intronic
937125099 2:119469825-119469847 GGCCCCATGTCCTCCAGGAGTGG - Intronic
938630793 2:133165026-133165048 GGCCAAATGTCACCTAGAAGAGG - Intronic
938682328 2:133704253-133704275 GGCCCCATGATAGCTACAATAGG + Intergenic
940686111 2:156852903-156852925 TGCCCAAGGTCCTCTAGAATGGG + Intergenic
941859741 2:170266749-170266771 AGCCCCATGTCATTTCTAATAGG + Intronic
945793420 2:214332879-214332901 GGCCACATGTAACCTGGAATGGG + Intronic
947696386 2:232193618-232193640 GTCCCCATTTCATCTATCATTGG + Intronic
1168897239 20:1332044-1332066 GTCTCCATGCCATCTGGAATGGG + Intronic
1184817722 22:46884763-46884785 GGACCCATTTCATCTAGATCAGG - Intronic
949677699 3:6475920-6475942 GAACCCATGTCCTCTAGATTAGG + Intergenic
953597834 3:44335045-44335067 GGCCCTTTTTCATCTAGAATGGG + Intergenic
957827863 3:85472649-85472671 GGTACCATGTTATCTATAATGGG + Intronic
960496104 3:118377221-118377243 GGCCCCAACTGATCCAGAATTGG + Intergenic
964399941 3:156288475-156288497 GGCCACATGTCAATTAGACTTGG - Intronic
969101005 4:4768308-4768330 AGCCCCATGTCATCAAGGAAGGG + Intergenic
974896200 4:67942287-67942309 GGCCCCATCTCCTCTATCATCGG - Intronic
981730956 4:147898049-147898071 TTCACCATGTTATCTAGAATGGG + Intronic
982925750 4:161335257-161335279 GGCCCCTTGCTATTTAGAATAGG + Intergenic
983572136 4:169221366-169221388 AACCCCATGTCATCTGGAAGAGG - Intronic
986247595 5:6024878-6024900 GACTCCATGTCAGCTAGAAGTGG - Intergenic
988678519 5:33459751-33459773 GGCCCGAGGTCATCCAGAGTCGG - Exonic
989451282 5:41589146-41589168 GGCCCCATGTTACCTCCAATAGG + Intergenic
990261845 5:54031491-54031513 GGGCAAATGTTATCTAGAATAGG - Intronic
997349588 5:133221100-133221122 TGCCCTAAGTCATCTAGAGTTGG + Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
997907065 5:137828482-137828504 GGCCCCATTTCAAATAAAATGGG + Intergenic
1000196055 5:158958967-158958989 GTCCCCAAGTCATCTTGAACTGG + Intronic
1001374940 5:171247340-171247362 GGCCCTGTGTCATCAAGAAAGGG + Intronic
1001759391 5:174194844-174194866 GGCCCTATGTCATCCACAGTTGG - Intronic
1002331141 5:178441872-178441894 GGCCCCAAGTCATCAATAACAGG + Intronic
1008246556 6:49181909-49181931 ATCCCCATGAAATCTAGAATAGG + Intergenic
1015212467 6:130713812-130713834 GGCTCCACATCATCTACAATAGG - Intergenic
1027219788 7:76206595-76206617 GGCCCCATGTCATCTAGAATAGG + Intronic
1032987496 7:137354635-137354657 GGCCCCAAGCCAACCAGAATTGG + Intergenic
1058678999 9:107425281-107425303 GGCCTGCTGGCATCTAGAATGGG - Intergenic
1191895174 X:65985080-65985102 GCCCCCATGTCATCTGGAACAGG - Intergenic
1192185123 X:68941542-68941564 GGCCCCAATTCATCTGAAATTGG - Intergenic
1195137941 X:101929915-101929937 GGCCCCATGCCCTCTCGATTTGG - Intronic
1197318695 X:125001289-125001311 GGCCCTATCTCATATAGAAAGGG - Intergenic