ID: 1027219792

View in Genome Browser
Species Human (GRCh38)
Location 7:76206599-76206621
Sequence GAGCCCTATTCTAGATGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027219792_1027219795 -10 Left 1027219792 7:76206599-76206621 CCATGTCATCTAGAATAGGGCTC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1027219795 7:76206612-76206634 AATAGGGCTCTCAGAGGGCCTGG 0: 1
1: 0
2: 0
3: 24
4: 155
1027219792_1027219802 10 Left 1027219792 7:76206599-76206621 CCATGTCATCTAGAATAGGGCTC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1027219802 7:76206632-76206654 TGGGTGGGTGAGCCGGGTTCAGG No data
1027219792_1027219797 -6 Left 1027219792 7:76206599-76206621 CCATGTCATCTAGAATAGGGCTC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1027219797 7:76206616-76206638 GGGCTCTCAGAGGGCCTGGGTGG No data
1027219792_1027219798 -5 Left 1027219792 7:76206599-76206621 CCATGTCATCTAGAATAGGGCTC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1027219798 7:76206617-76206639 GGCTCTCAGAGGGCCTGGGTGGG 0: 1
1: 1
2: 5
3: 44
4: 342
1027219792_1027219799 3 Left 1027219792 7:76206599-76206621 CCATGTCATCTAGAATAGGGCTC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1027219799 7:76206625-76206647 GAGGGCCTGGGTGGGTGAGCCGG 0: 1
1: 1
2: 9
3: 78
4: 680
1027219792_1027219800 4 Left 1027219792 7:76206599-76206621 CCATGTCATCTAGAATAGGGCTC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1027219800 7:76206626-76206648 AGGGCCTGGGTGGGTGAGCCGGG No data
1027219792_1027219796 -9 Left 1027219792 7:76206599-76206621 CCATGTCATCTAGAATAGGGCTC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1027219796 7:76206613-76206635 ATAGGGCTCTCAGAGGGCCTGGG 0: 1
1: 0
2: 10
3: 26
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027219792 Original CRISPR GAGCCCTATTCTAGATGACA TGG (reversed) Intronic
900942342 1:5808059-5808081 GAGACCTGTTCTAGCTGTCAGGG + Intergenic
903112700 1:21150335-21150357 AAGCCTTATTTTAAATGACATGG - Intronic
919923007 1:202177436-202177458 GAGCCCCATGCTTGATGCCAGGG - Intergenic
920614142 1:207472791-207472813 GTGCCCCATTGTAGATAACAGGG - Exonic
920676812 1:208043800-208043822 AAGCCCTCTGCTGGATGACAGGG - Intronic
920813308 1:209307315-209307337 TAGACCTATGCTAGAGGACATGG + Intergenic
920950435 1:210567155-210567177 GGGCACTATTCTTGATGAAATGG - Intronic
921412731 1:214853094-214853116 CAACCCTATTCTAGAAGATAAGG + Intergenic
1073021673 10:100449969-100449991 GAGCTCTAAAATAGATGACAAGG - Intergenic
1074405288 10:113176156-113176178 GATCCCTGATCTAGATTACAAGG - Intergenic
1074578472 10:114693509-114693531 GAACCCTATGATGGATGACAGGG - Intergenic
1078963939 11:16314557-16314579 AATCCCTATGCTAGATGATATGG - Intronic
1081116242 11:39204599-39204621 AAGACATGTTCTAGATGACAGGG + Intergenic
1081387350 11:42487413-42487435 TAGTCCTATGCTAGATGATACGG + Intergenic
1085372528 11:76022651-76022673 GAGACTTATTCTAGATAAAAAGG - Intronic
1089038839 11:115426377-115426399 CAGCCCTACTCTGGGTGACATGG - Intronic
1089612649 11:119678069-119678091 GAGGCCTAAGCTCGATGACAGGG - Intronic
1089830496 11:121323325-121323347 GGGTCCTTTTCTAGAGGACAAGG - Intergenic
1090397065 11:126425881-126425903 GAGCCCCATCCTAGGAGACAGGG + Intronic
1090863067 11:130671925-130671947 GAGCCATAAACTGGATGACAGGG - Intergenic
1096845373 12:54403660-54403682 GAGCCCCATTCTGGATGAGCAGG + Exonic
1097806339 12:63968793-63968815 GAGCCCTAGTCTAGGAGACTGGG + Intronic
1103747608 12:123136468-123136490 GAGCTGTGTTCTAGATTACATGG - Intronic
1107709979 13:43142017-43142039 CAGCACTCTTCTAGATGTCACGG + Intergenic
1109094755 13:58098562-58098584 GAAGCCTATTCTAGAAGAAAAGG + Intergenic
1111835988 13:93388841-93388863 AAGCCCTTTCCTAGATGCCAGGG - Intronic
1113269609 13:108658997-108659019 GATTTTTATTCTAGATGACATGG + Intronic
1117870519 14:60195704-60195726 GAGCCCTCTTCAAACTGACATGG + Intergenic
1124546770 15:30635957-30635979 GTATCCTATTCTAGATGAGAAGG + Intronic
1124780375 15:32625957-32625979 GTATCCTATTCTAGATGAGAAGG + Intronic
1128285998 15:66437631-66437653 GATCCCTATTCTAAAGGTCAGGG - Intronic
1131246459 15:90797872-90797894 GAGCACTATTCTAGGAGGCATGG + Intronic
1135294280 16:21265618-21265640 AGGCACTATTCTAGATGCCAGGG - Intronic
1137483535 16:48872622-48872644 AAGCACTATTGTAGAAGACACGG - Intergenic
1139275374 16:65722899-65722921 GACCTCTGCTCTAGATGACACGG + Intergenic
1141718952 16:85744422-85744444 GAGCCCAATTCAATATGAAACGG - Intronic
1144440362 17:15275894-15275916 GAGCCACAGTCTTGATGACAAGG + Intergenic
1157083217 18:44550951-44550973 GAGCCATTTTCTAAATGACCTGG - Intergenic
1165698979 19:37922727-37922749 GAGCACTGTTCTAGATACCAGGG + Intronic
926813929 2:16781714-16781736 GGGACCTATTCTAGATGAGGTGG - Intergenic
927344542 2:22022557-22022579 AAGCCCTATTCTGCAAGACATGG + Intergenic
928623386 2:33114224-33114246 AATCCCTACTCTAGATGATACGG - Intronic
933589983 2:84221833-84221855 GAGCTCTCTTGTACATGACAAGG + Intergenic
936732340 2:115398849-115398871 CATCCCTATTTCAGATGACATGG - Intronic
939929710 2:148217671-148217693 GAGTCCTATTCTGTATGACTGGG + Intronic
940849045 2:158671121-158671143 CAGGCTTATTCTAGATGCCAAGG - Intronic
941282743 2:163573296-163573318 AAGTCCTATTTTAGATGACTTGG + Intergenic
944150567 2:196554008-196554030 CAGCCCTATCCTAGATATCAGGG - Intronic
945052099 2:205833852-205833874 TAGCCCATTTCTAGAGGACAAGG + Intergenic
947964719 2:234269773-234269795 CAGGTCTATTCTAGATGCCAGGG - Intergenic
948708429 2:239810262-239810284 AAGCTCTGTTCTAGATGACATGG - Intergenic
1171162439 20:22940396-22940418 GAGCCCTCTTCCAGATAAAAGGG + Intergenic
1172427354 20:34864006-34864028 GAGCCCTATGCTAGGTGCCAGGG + Intronic
1173058823 20:39642549-39642571 GAGCCATATTATAAATGCCAGGG - Intergenic
1177097913 21:16861134-16861156 GAGCCCTATTCTAGGAGGTAGGG - Intergenic
1177451660 21:21275961-21275983 CAGCAATATTCTAGATGAGATGG + Intronic
1182203616 22:28599693-28599715 GAGCCTTCTTCTAATTGACATGG - Intronic
1182275202 22:29183906-29183928 GGGCCCTAATTTAGATGACAGGG - Intergenic
1184817718 22:46884759-46884781 GACCCCTGATCTAGATGAAATGG + Intronic
1185100279 22:48836660-48836682 GAGCCCTGTTCCAGATGCCCAGG + Intronic
949378905 3:3422453-3422475 TAGACCTAGTTTAGATGACAAGG - Intergenic
949461108 3:4295450-4295472 GTGCCTTATTATAGATGAGAAGG + Intronic
954277438 3:49551921-49551943 GAGCCCCAGTCTAGATCAAAAGG + Intergenic
961621017 3:128225127-128225149 GAGCTCTTTTCTGGAAGACAGGG + Intronic
961621033 3:128225236-128225258 GAGCTCTTTTCTGGAAGACAGGG + Intronic
961938937 3:130617211-130617233 GGGCCCTATTCTAGGATACAAGG + Intronic
963334180 3:143953533-143953555 GAGCCATATTCCAGATGTGATGG + Intergenic
964580395 3:158227948-158227970 GAGCACTATTCTATACAACAGGG - Intronic
971268749 4:25117613-25117635 GAGCTCTATTCTAGGAGAGATGG + Intergenic
973607091 4:52598993-52599015 AGGCCCTATTCTAGCTGTCAGGG + Intronic
975645378 4:76540939-76540961 GAGCCCTATTCTATTTGAATTGG + Intronic
983572133 4:169221362-169221384 GAGTCCTCTTCCAGATGACATGG + Intronic
989166686 5:38439296-38439318 GAAGCCTATTCTAGATACCAGGG - Intronic
992418553 5:76578050-76578072 AAGCCCAAATCAAGATGACAGGG - Intronic
994131654 5:96235922-96235944 TACCCCTATTCCAGATCACAAGG + Intergenic
1002167031 5:177354372-177354394 AAGCACTATTCTAGATGCCAGGG - Intergenic
1004119832 6:12810396-12810418 GAGCGTTTTTCTAGATGCCAGGG - Intronic
1006186939 6:32186781-32186803 AAGCCCTATTCGAGAGGAGATGG + Intronic
1007779995 6:44247275-44247297 GAGCCTTAGTCTAGATGTCGGGG + Intronic
1012372400 6:98523668-98523690 GAGCTCTTTTCTAAAGGACATGG + Intergenic
1014537277 6:122629209-122629231 GAGCTATATGCTAGATGTCAAGG + Intronic
1015861605 6:137686938-137686960 GATCCCTCTGCTGGATGACATGG + Intergenic
1017729559 6:157303171-157303193 CAGCTCTGTTCTAGAGGACAGGG - Intronic
1021790878 7:24204386-24204408 GGGTGCTATTTTAGATGACAGGG + Intergenic
1024671689 7:51601330-51601352 GAAGTCTATACTAGATGACAGGG + Intergenic
1026952161 7:74354822-74354844 GACCCCAATGCCAGATGACAGGG - Intronic
1027219792 7:76206599-76206621 GAGCCCTATTCTAGATGACATGG - Intronic
1027463445 7:78484691-78484713 GAGCCCTATAGAAGATGACTGGG - Intronic
1033647999 7:143319854-143319876 GATCACTATTCTAAATGTCAAGG + Exonic
1037152842 8:15658179-15658201 GAGCACTAATGTAGATAACATGG + Intronic
1037163298 8:15797715-15797737 GAGAACTATTCTAGATGCCTTGG + Intergenic
1043161315 8:76851439-76851461 TAGCTCTATTCCAGATGACATGG + Exonic
1050849023 9:10260577-10260599 GAGCTCAATTCTTGAGGACATGG - Intronic
1058092168 9:100816756-100816778 GAGGACTATGCTAGATGCCAAGG - Intergenic
1060816226 9:126636742-126636764 GAGCCCTGACCTAGAGGACAAGG - Intronic
1062356341 9:136165591-136165613 CAACCATATTCTATATGACACGG + Intergenic
1187783880 X:22862263-22862285 AAACCCTAGTCTAGATGTCATGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1191851972 X:65591849-65591871 GGACCCTAGTCTAGATGGCAGGG - Intronic
1191895169 X:65985076-65985098 AGGCCCTGTTCCAGATGACATGG + Intergenic
1192143518 X:68664808-68664830 GAGCACTATGCTAGATGCTAAGG - Intronic
1192867882 X:75155190-75155212 TAGCCCTGTGCTAGATGATAGGG - Intronic
1195078568 X:101349899-101349921 GAGCAATATTCTAGATGTCATGG - Exonic
1196981815 X:121222702-121222724 TTGCCCTATCCTAGATGCCAGGG + Intergenic
1198122598 X:133608624-133608646 AAGCCCAATGCTTGATGACATGG - Intronic
1198318895 X:135498808-135498830 AAGCCCTGTTCTAGATGATGTGG + Intergenic