ID: 1027220544

View in Genome Browser
Species Human (GRCh38)
Location 7:76211159-76211181
Sequence GGCTACCGGGACACCGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027220531_1027220544 30 Left 1027220531 7:76211106-76211128 CCAGCCAAGAATGTTTTTTAGAT 0: 1
1: 0
2: 13
3: 105
4: 647
Right 1027220544 7:76211159-76211181 GGCTACCGGGACACCGGTGTGGG No data
1027220533_1027220544 26 Left 1027220533 7:76211110-76211132 CCAAGAATGTTTTTTAGATGGAC 0: 1
1: 0
2: 1
3: 18
4: 234
Right 1027220544 7:76211159-76211181 GGCTACCGGGACACCGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027220544 Original CRISPR GGCTACCGGGACACCGGTGT GGG Intronic
No off target data available for this crispr