ID: 1027223121

View in Genome Browser
Species Human (GRCh38)
Location 7:76226528-76226550
Sequence CTGTATCAGCAGAAAGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 520}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027223107_1027223121 22 Left 1027223107 7:76226483-76226505 CCTCAGTTGAACTCTAAGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 1027223121 7:76226528-76226550 CTGTATCAGCAGAAAGGAAGTGG 0: 1
1: 0
2: 3
3: 41
4: 520
1027223116_1027223121 -10 Left 1027223116 7:76226515-76226537 CCCCGGCTCCTGGCTGTATCAGC 0: 1
1: 0
2: 2
3: 19
4: 239
Right 1027223121 7:76226528-76226550 CTGTATCAGCAGAAAGGAAGTGG 0: 1
1: 0
2: 3
3: 41
4: 520
1027223115_1027223121 -1 Left 1027223115 7:76226506-76226528 CCGGTGGGGCCCCGGCTCCTGGC 0: 1
1: 0
2: 2
3: 36
4: 341
Right 1027223121 7:76226528-76226550 CTGTATCAGCAGAAAGGAAGTGG 0: 1
1: 0
2: 3
3: 41
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027223121 Original CRISPR CTGTATCAGCAGAAAGGAAG TGG Intronic
901409885 1:9075408-9075430 CGGTATCAGCAGAAGAGGAGCGG - Intronic
901958215 1:12803131-12803153 TTGTATAAGGTGAAAGGAAGGGG + Intergenic
901966210 1:12869031-12869053 TTGTATAAGGTGAAAGGAAGGGG + Intronic
902115476 1:14117513-14117535 CTTTATCAGCAGCATGAAAGTGG + Intergenic
902165527 1:14568352-14568374 CTTTATCAGCAGCATGAAAGCGG - Intergenic
902374261 1:16022920-16022942 CTGTATCTCCTGAAAGGCAGAGG - Intronic
902379214 1:16044797-16044819 CTGTATCTCCCGAAAGGCAGAGG - Intronic
902686886 1:18083484-18083506 CAGCATCAGGAGAATGGAAGAGG - Intergenic
904259274 1:29279176-29279198 CTGTAGCAGCAGAGAGAAAGAGG - Intronic
904840445 1:33368789-33368811 CAGTAGAAGCAGAAAGGAAGGGG + Intronic
904916476 1:33973977-33973999 CTGCAGCAGAAGAAGGGAAGTGG - Intronic
905241431 1:36583994-36584016 CTTTCTTAGCAGACAGGAAGGGG - Intergenic
905308948 1:37036534-37036556 CAGAAGCAGCAGAAAGGTAGAGG + Intergenic
906103111 1:43275634-43275656 CTGTCTCAGATGAAAGGAAAGGG - Intergenic
906241289 1:44243693-44243715 CTGTAGCAGCAGAGAGGGAGTGG + Intronic
906292403 1:44627848-44627870 CTGTGTCAGCTGGAAGGAAGGGG - Intronic
906810624 1:48823604-48823626 CTGTGTGAGCAGCAAGGAAGGGG - Intronic
907515192 1:54989412-54989434 CTGACTCAGCTGAAAGGCAGTGG + Intronic
907777891 1:57536757-57536779 CTGCGGCAGCAGAAAGGGAGAGG - Intronic
908288564 1:62637914-62637936 ATGTATCAGCAGGAAGTTAGAGG - Intronic
908435577 1:64102419-64102441 CTTTGTGAGAAGAAAGGAAGTGG - Intronic
909095989 1:71290051-71290073 CTTTATCAGCAGAATGAAAGTGG + Intergenic
909295285 1:73939626-73939648 CTGCATCAGCAGACAGGAAAGGG - Intergenic
909868934 1:80713719-80713741 CTATAACAGCAGTAAGAAAGAGG + Intergenic
910895712 1:92067124-92067146 CTGTATTGGCAAAAAGGATGGGG - Intergenic
911307983 1:96254766-96254788 CTTTATCAGCAGCATGAAAGTGG + Intergenic
911467332 1:98272267-98272289 CTGTATAAGGTGTAAGGAAGGGG - Intergenic
911540905 1:99157327-99157349 TTGTATCAGGTGTAAGGAAGGGG + Intergenic
911773809 1:101782326-101782348 CTGGATCAGCAAAAAATAAGAGG - Intergenic
912299181 1:108496162-108496184 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
912589792 1:110805391-110805413 CTGTATGTGGTGAAAGGAAGGGG - Intergenic
913063760 1:115231170-115231192 CAGCAACAGCAGCAAGGAAGGGG + Intergenic
915287193 1:154860571-154860593 CTGTGTGAGTAAAAAGGAAGTGG - Intronic
915450547 1:156002213-156002235 CAGGTCCAGCAGAAAGGAAGAGG - Intronic
915654704 1:157349850-157349872 CTTTATCAGCAGCAAGAAAATGG - Intergenic
916153375 1:161818986-161819008 CTGTATTAGGAGAGTGGAAGAGG + Intronic
916220599 1:162440948-162440970 CTGTAGCAGCAGGAGGGATGTGG - Intergenic
916734643 1:167597164-167597186 CTTTATCAGCAGAGTGGAATCGG - Intergenic
916757523 1:167787061-167787083 CAGCCTCAGCAGTAAGGAAGAGG - Intronic
916761426 1:167820930-167820952 CTGTCTCAGAAAGAAGGAAGGGG + Intronic
916906452 1:169290483-169290505 TTGTATAAGATGAAAGGAAGGGG - Intronic
917584441 1:176411828-176411850 TTGTATAAGGTGAAAGGAAGGGG + Intergenic
917892265 1:179451880-179451902 CTTTATCAGCAGAATGAAAATGG + Intronic
918429552 1:184444571-184444593 CTTTATCAGCAGAATGAAAATGG + Intronic
918525506 1:185460063-185460085 CTGTATAAGGTGTAAGGAAGGGG - Intergenic
918712297 1:187746746-187746768 GTTCAGCAGCAGAAAGGAAGAGG + Intergenic
919163606 1:193863661-193863683 CTTTATCAGCAGCATGAAAGCGG + Intergenic
920737297 1:208544546-208544568 ATGAATTAACAGAAAGGAAGAGG + Intergenic
921329499 1:214021406-214021428 CTGTAAAATCAGAAAGGAAATGG - Intronic
921342211 1:214145385-214145407 ATGTATTTGCAGAAAGGCAGAGG - Intergenic
922147522 1:222962748-222962770 TTGTATAAGGAGTAAGGAAGGGG - Intronic
923518221 1:234715488-234715510 CTGTAGGAGAACAAAGGAAGTGG - Intergenic
923686865 1:236159791-236159813 CTGTGTCATCCGAAAGGATGGGG + Intronic
923774245 1:236964265-236964287 CTCCATCAGCAGAAGTGAAGAGG + Intergenic
924300099 1:242628509-242628531 CTGAATCAGCTGGAAAGAAGTGG - Intergenic
1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG + Intergenic
1063616818 10:7607473-7607495 CTGTCTCTACAGAAAGAAAGAGG + Intronic
1063726803 10:8646044-8646066 GTGTTACAGCAGAAATGAAGTGG - Intergenic
1063744217 10:8861422-8861444 CTGTATCAACAGCCAGGAAGTGG - Intergenic
1063898659 10:10709132-10709154 ATACATCAGCAGAAAGGAAGCGG + Intergenic
1064313357 10:14232102-14232124 TTGTATATGGAGAAAGGAAGGGG + Intronic
1064344077 10:14514922-14514944 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
1064898653 10:20269485-20269507 CTGGCTAAGCAGAGAGGAAGGGG + Intronic
1065426316 10:25608006-25608028 CTGTAGAAGCAGAATGCAAGGGG - Intergenic
1065461722 10:25973909-25973931 CTGTATAAGGTGTAAGGAAGGGG - Intronic
1065795269 10:29301354-29301376 CTTTATCAGCAGAATGAAAATGG + Intronic
1066259322 10:33713710-33713732 CTGCATGAACAGAAAGGGAGAGG + Intergenic
1066623555 10:37382881-37382903 CTGTCTCAGCAGAAAAGAATGGG - Intronic
1066754110 10:38692426-38692448 CTTTATCAGCAGAATGAAAACGG + Intergenic
1067576656 10:47413038-47413060 CTTTATCAGCACCAAGGAAGAGG + Intergenic
1068098774 10:52525554-52525576 CCGTATCACCAGATAGTAAGTGG - Intergenic
1068853835 10:61776071-61776093 ATATTTCAGCAGAAAGGAAATGG - Intergenic
1069603132 10:69722134-69722156 GTGTCTCAGCTGACAGGAAGAGG - Intergenic
1070934656 10:80283865-80283887 CTCTATCAGCAGAGAGCAACAGG + Intronic
1071071718 10:81701871-81701893 TTGTATAAGCTGTAAGGAAGGGG - Intergenic
1072837736 10:98735147-98735169 CTCTATCAGCAGCAAGAAAAGGG + Intronic
1073721962 10:106182813-106182835 CTGAACCTGTAGAAAGGAAGAGG + Intergenic
1073748237 10:106494311-106494333 CTGTAGCATCAGTAAGGTAGTGG - Intergenic
1074228708 10:111512862-111512884 CTGTATCAGAAGCAAGCAGGAGG - Intergenic
1074287353 10:112110619-112110641 CTTTATCAGCAGCATGGAAATGG + Intergenic
1074673650 10:115824246-115824268 CTGTATAAGGTGTAAGGAAGGGG - Intronic
1075497105 10:122931702-122931724 CTGTATCAGCTCAAAAGGAGAGG + Exonic
1075882166 10:125862273-125862295 CTGTATGAAAAGAAAGGCAGAGG - Intronic
1076518379 10:131062830-131062852 CTGTCTCAGCAGGAAGAAGGAGG - Intergenic
1078851138 11:15165017-15165039 CTGTATCAGCAGCATGAAAATGG + Intronic
1079016064 11:16869976-16869998 CTGTCTCAGATGAATGGAAGGGG + Intronic
1079710976 11:23681028-23681050 CTGCAGCAGCAGACAGCAAGAGG + Intergenic
1080044724 11:27797023-27797045 CTGTACCTGCTGGAAGGAAGGGG + Intergenic
1080112023 11:28578947-28578969 CTGAGTCAGCAAGAAGGAAGGGG - Intergenic
1081240397 11:40698653-40698675 CTTTATCAGCAGCAAGAAAATGG - Intronic
1081653414 11:44840637-44840659 CTGTTTCAACAGAAACGCAGCGG + Intronic
1083334856 11:61916682-61916704 CTGTATGTGCAGAAAGGTTGTGG - Intronic
1083368799 11:62161739-62161761 TTGTATAAGCTGTAAGGAAGGGG - Intergenic
1085577370 11:77618776-77618798 CTGTATCAGAAGAAAAGAGAAGG + Intronic
1085847348 11:80081523-80081545 CTGAAGCAGCTGAAAGGAAAGGG + Intergenic
1085907006 11:80775446-80775468 CTTTATCAGCAGCATGGAAATGG + Intergenic
1086003328 11:82005483-82005505 CTGAATCAGCAAAAAGAAAGAGG - Intergenic
1086349342 11:85929737-85929759 TTGTATAAGCTGTAAGGAAGGGG - Intergenic
1086850192 11:91799430-91799452 CTTTATCAGCAGAATGAAAATGG - Intergenic
1088086461 11:105986722-105986744 CTGGTACAGCAGAAAGGAAGTGG + Intergenic
1088712458 11:112520910-112520932 CAGTATCTGCAGTCAGGAAGTGG + Intergenic
1089021555 11:115220757-115220779 CTCTTTCAGGACAAAGGAAGGGG - Intronic
1089642416 11:119856585-119856607 CTGTATCTGCTAAAAGGATGTGG + Intergenic
1090510549 11:127370125-127370147 CACTAACAGCAAAAAGGAAGGGG - Intergenic
1090690060 11:129171343-129171365 TTGTATAAGGTGAAAGGAAGGGG + Intronic
1091040803 11:132279347-132279369 CTCTAGCAGCAGAATGGAGGAGG - Intronic
1092906516 12:13104667-13104689 CTGTATGAGCAAAGAGGAAATGG - Intronic
1093207219 12:16264920-16264942 CTTTATCAGCAGCATGAAAGTGG + Intronic
1095655031 12:44659169-44659191 TTGTATCAGGTGTAAGGAAGGGG - Intronic
1095831863 12:46596459-46596481 TTGTATAAGAAGTAAGGAAGGGG + Intergenic
1097008284 12:55934545-55934567 TTGCATCATCAGAAAGGAAAAGG + Intronic
1097278863 12:57832061-57832083 CTGCCTCAACAGAAAGGCAGAGG + Intronic
1098275725 12:68809064-68809086 CTGGATCAGCAGAGAAAAAGTGG - Intronic
1098823764 12:75267840-75267862 CAGAAACAGCAGAAAGGCAGAGG + Intergenic
1099011044 12:77291511-77291533 CTGTATGAGGTGTAAGGAAGAGG - Intergenic
1099222646 12:79934063-79934085 CTGCACCGGCTGAAAGGAAGGGG - Intronic
1099441358 12:82703365-82703387 CTGTATCATCAGCAAGGAAGAGG - Intronic
1101132267 12:101701245-101701267 CTGGTACAGAAGAAAGGAAGAGG - Intronic
1102783233 12:115583674-115583696 GTGTTTCAGCAGAAGGAAAGTGG - Intergenic
1103850830 12:123932124-123932146 CTGAATCGGCAGAGAGGAGGCGG - Intronic
1104342695 12:127966437-127966459 CTTTATCAGCAGCATGGAAATGG - Intergenic
1105285851 13:19002959-19002981 CTGTATAAGGTGTAAGGAAGTGG + Intergenic
1105309518 13:19193802-19193824 CCGTCTCAACAAAAAGGAAGAGG + Intergenic
1105393456 13:20004698-20004720 CTGGATAAGTAGAAAGTAAGAGG - Intronic
1105492130 13:20899089-20899111 CTGTCTCAAAAGAAAGGGAGGGG + Intronic
1107216808 13:37931187-37931209 CTGTATCAGCAAAATGAAAAAGG - Intergenic
1107635473 13:42388125-42388147 CTGTGTCAGCAGAAAGCAAAGGG + Intergenic
1108477341 13:50834008-50834030 TTGTATAAGCTGTAAGGAAGGGG - Intronic
1108609549 13:52070701-52070723 CTTTATCAGCAGCAAGAAAATGG + Intronic
1109640488 13:65185157-65185179 CTGTATAAGGTGTAAGGAAGAGG - Intergenic
1109952084 13:69511991-69512013 CTTTATCAGCAGCATGGAAATGG + Intergenic
1110019665 13:70454876-70454898 CAGTTACAGCAGAAGGGAAGAGG + Intergenic
1110530765 13:76595036-76595058 TTGTATAAGCTGTAAGGAAGGGG - Intergenic
1110890730 13:80694566-80694588 CTGTATAAGGTGTAAGGAAGGGG - Intergenic
1110908701 13:80926487-80926509 CTGTCTCAGTAGTAAGAAAGGGG + Intergenic
1111017827 13:82404216-82404238 CTGTATAAGGTGTAAGGAAGGGG - Intergenic
1111334445 13:86802019-86802041 CTTTATCAGCAGCAAGAAAACGG + Intergenic
1111527456 13:89491427-89491449 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1112200499 13:97269478-97269500 CTGGATGAGCAGGGAGGAAGGGG - Intronic
1112872676 13:103994048-103994070 CTTTATCAGCAGCAAGGACACGG + Intergenic
1113085347 13:106564596-106564618 CTGTATTTGCAGTTAGGAAGAGG - Intronic
1113131219 13:107039236-107039258 TTGTATAAGGTGAAAGGAAGGGG + Intergenic
1113304856 13:109066388-109066410 CAGTTTCAGCAGAAAGAAAATGG - Intronic
1113393450 13:109920043-109920065 TTGCATCAGCAGAAAGAAAATGG + Intergenic
1115534368 14:34358662-34358684 CTCCATCTTCAGAAAGGAAGGGG - Intronic
1115776810 14:36724374-36724396 CAGCATCAGCAGGCAGGAAGTGG + Intronic
1115822170 14:37224349-37224371 CTTTATCAGCAGCATGAAAGTGG - Intronic
1115968328 14:38916708-38916730 CTTTATCAGCAGCAAGAAAATGG - Intergenic
1116193128 14:41685637-41685659 TTGTATAAGCTGTAAGGAAGGGG + Intronic
1116245789 14:42410376-42410398 CAATAACAGCATAAAGGAAGAGG - Intergenic
1116792072 14:49349752-49349774 CTGTATAAGGTGTAAGGAAGGGG + Intergenic
1117212394 14:53514047-53514069 TTGTCTCAGCTGTAAGGAAGTGG + Intergenic
1117938433 14:60934709-60934731 CTTTATCAGCAGCAAGAAAATGG + Intronic
1118315663 14:64724501-64724523 ATGGGTAAGCAGAAAGGAAGAGG - Intronic
1118725127 14:68623557-68623579 CTGTATCCACAAAGAGGAAGGGG + Intronic
1119216177 14:72870922-72870944 CTTTATCAGCAGCATGAAAGTGG - Intronic
1120005260 14:79349357-79349379 CTGTGTAAGCAGAAAGCAGGAGG + Intronic
1120396817 14:83977883-83977905 CAGTATCAGAAAAAAGGCAGAGG + Intergenic
1121003374 14:90468859-90468881 TTGTATAAGATGAAAGGAAGGGG + Intergenic
1121527464 14:94629009-94629031 ATGTACCAGCAGAAAAGGAGAGG + Intergenic
1122670477 14:103367892-103367914 CTGTCTCAGAAAAAAAGAAGGGG + Intergenic
1123429391 15:20202045-20202067 AAGTATCAGCAGAAATTAAGAGG + Intergenic
1124894430 15:33763086-33763108 CTGTATAAGGTGTAAGGAAGGGG - Intronic
1124966954 15:34439919-34439941 CTTTATCAGCTGTAAGGAAACGG - Intergenic
1125015449 15:34929362-34929384 TTGTATAAGCTGTAAGGAAGGGG + Intronic
1125572436 15:40731056-40731078 TTGTATCTGAGGAAAGGAAGAGG + Exonic
1126003848 15:44237816-44237838 CTTTATCAGCAGCATGGAAACGG - Intergenic
1126084841 15:45001762-45001784 CACTATTGGCAGAAAGGAAGAGG - Intergenic
1126484069 15:49159865-49159887 CTGTATCAGTTGAAAGGATTCGG + Intronic
1127514479 15:59678512-59678534 CTGTAATACCAGATAGGAAGTGG + Intronic
1127521962 15:59751956-59751978 CCTTAGCAGCAGATAGGAAGAGG - Intergenic
1127769875 15:62222626-62222648 CTAATTCAGGAGAAAGGAAGAGG + Intergenic
1128371021 15:67039499-67039521 CTATTTGAGCAGAAAGCAAGGGG - Intergenic
1128704985 15:69832195-69832217 CTGTTTCAGGAGAAAGGCAGGGG + Intergenic
1129713073 15:77831263-77831285 CTGTATCAAAAAAAAGGGAGGGG - Intergenic
1130028348 15:80289480-80289502 CTGTGACAGCAGAAATGAGGAGG + Intergenic
1130136141 15:81183413-81183435 CTGTACCTGCAGGAAGGTAGGGG - Intronic
1130647884 15:85744679-85744701 CTGCCTCAGCAGAGAGGAAGAGG - Exonic
1132222751 15:100117131-100117153 CTGTAACAGCAGAGAGGGGGTGG - Intronic
1133401683 16:5492193-5492215 CTGTATCTGCAGAGAGGAGTAGG - Intergenic
1133747701 16:8699829-8699851 CTGTCTCAAAAGAAAGAAAGAGG - Intronic
1134139323 16:11703788-11703810 TTGTATCAGAAGTAAAGAAGTGG + Intronic
1134501667 16:14773585-14773607 TTGTATCAGGTGTAAGGAAGGGG + Intronic
1134578897 16:15355293-15355315 TTGTATCAGGTGTAAGGAAGGGG - Intergenic
1134723690 16:16402257-16402279 TTGTATCAGGTGTAAGGAAGGGG + Intergenic
1134943739 16:18309613-18309635 TTGTATCAGGTGTAAGGAAGGGG - Intergenic
1135988565 16:27202826-27202848 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1135997510 16:27262561-27262583 CTGTATGTGCTGTAAGGAAGGGG - Intronic
1136581158 16:31151673-31151695 CTTTACCAGCAGAGAGGGAGTGG + Intergenic
1136681538 16:31967986-31968008 TTGTATAAGCTGTAAGGAAGGGG - Intergenic
1136781846 16:32909483-32909505 TTGTATAAGCTGTAAGGAAGGGG - Intergenic
1136854113 16:33639500-33639522 CTGAGGCAGCAGACAGGAAGGGG + Intergenic
1136854931 16:33647684-33647706 AAGTATCAGCAGAAATTAAGAGG - Intergenic
1136887948 16:33944364-33944386 TTGTATAAGCTGTAAGGAAGGGG + Intergenic
1137682290 16:50359925-50359947 CTGAGGCAGGAGAAAGGAAGAGG + Intronic
1138202744 16:55102118-55102140 CTGGATCAGCAGGAGGGAAGGGG - Intergenic
1140261011 16:73379625-73379647 CAATGTAAGCAGAAAGGAAGAGG + Intergenic
1140275755 16:73507209-73507231 CTGTATCAGTAAAGAGGAAGAGG + Intergenic
1140587472 16:76309951-76309973 CTTTATCAGCAGCATGGAAACGG + Intronic
1140588411 16:76322177-76322199 CTGAATCAGCAGGAAGGCAGGGG - Intronic
1141026541 16:80554143-80554165 CTGTGTCAGGAGGAAGGAAATGG - Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1142103872 16:88291727-88291749 GAATATCAGCAGAAAGGAAATGG + Intergenic
1203084501 16_KI270728v1_random:1173474-1173496 TTGTATAAGCTGTAAGGAAGGGG - Intergenic
1203115690 16_KI270728v1_random:1487939-1487961 CTGAGGCAGCAGACAGGAAGGGG + Intergenic
1203116508 16_KI270728v1_random:1496169-1496191 AAGTATCAGCAGAAATTAAGAGG - Intergenic
1143744968 17:8986279-8986301 CTGTCTCAAAAAAAAGGAAGTGG + Intergenic
1143839009 17:9716611-9716633 ATGAACCTGCAGAAAGGAAGAGG - Intronic
1144432374 17:15205744-15205766 TTGTATCAGGTGTAAGGAAGGGG - Intergenic
1146401806 17:32505416-32505438 AGGTATCAGAAGAAAGGAGGGGG + Intronic
1146436674 17:32856234-32856256 CTGGAGCAGCAGACATGAAGAGG - Intronic
1148110651 17:45143313-45143335 CTGCACCACTAGAAAGGAAGTGG - Intronic
1149232924 17:54555611-54555633 CAGGATCAGCAGCAGGGAAGAGG - Intergenic
1149246904 17:54719884-54719906 TTGTATAAGCTGTAAGGAAGGGG - Intergenic
1149560008 17:57601753-57601775 CTGATTCACCAGAAAGGAATCGG + Intronic
1150091784 17:62332752-62332774 CTGTCTCAAAAGAAAAGAAGAGG + Intergenic
1150893080 17:69177362-69177384 CTGGACCAGCATACAGGAAGAGG - Intronic
1150971365 17:70031940-70031962 CTGTATCAGCAGCATGAAAACGG - Intergenic
1151195071 17:72425509-72425531 CTGTATCAGCAGCATGAAAATGG + Intergenic
1153742829 18:8146825-8146847 TTGTATCAGGTGTAAGGAAGGGG + Intronic
1153779399 18:8480694-8480716 CAGTATCAGCTACAAGGAAGAGG + Intergenic
1155620071 18:27768291-27768313 CAGTCTCAGTAGGAAGGAAGAGG + Intergenic
1155676192 18:28431884-28431906 CTCTATCACCAGAATGGAAGAGG - Intergenic
1155856877 18:30845438-30845460 TTGTATAAGGAGTAAGGAAGGGG + Intergenic
1156013842 18:32525744-32525766 CTGTAACAGGAGAAAGGAGATGG - Intergenic
1156265736 18:35487311-35487333 CTGTATCAGCAGCATGAAAATGG - Intronic
1157481879 18:48060414-48060436 CTGAGTCAGGAGCAAGGAAGAGG - Intronic
1158353023 18:56583563-56583585 CTGTCTCAGAAAAAAGGAGGTGG + Intergenic
1159568176 18:70080383-70080405 CTGTACCAGAAGTAAGGAAATGG + Intronic
1160181300 18:76638811-76638833 CTGCCTCAGGAGAGAGGAAGTGG - Intergenic
1160455709 18:78997599-78997621 AGGTTTCAGGAGAAAGGAAGTGG - Exonic
1161136867 19:2625072-2625094 TTGTCTCAAAAGAAAGGAAGAGG - Intronic
1165886562 19:39083457-39083479 TTGTATCTGCAGTCAGGAAGGGG + Intergenic
1165919905 19:39289908-39289930 CTGGATGAACAGAAAGAAAGTGG - Intergenic
1166255480 19:41601418-41601440 CTGTATCAGCAGACATGTATTGG - Intronic
1166487414 19:43225288-43225310 CAGTGTGAGCAGAAAGGAAATGG + Intronic
1166834755 19:45660540-45660562 CTGTCTCAAAAGAAAAGAAGAGG + Intergenic
1167762614 19:51458862-51458884 CTCTCTCAGCAGCAACGAAGTGG + Intergenic
1168104225 19:54156791-54156813 CAGTCGCAGCAGAAAGGAAAAGG - Exonic
1168462493 19:56570880-56570902 CTTCATCAGTAGAGAGGAAGGGG - Intronic
1168463332 19:56580735-56580757 TTCTATCAGCAGAAGTGAAGAGG - Exonic
925103037 2:1265810-1265832 ATATGGCAGCAGAAAGGAAGGGG - Intronic
925151975 2:1621103-1621125 CTTTATCAGCAGCATGAAAGTGG + Intergenic
925467142 2:4116475-4116497 TTGTATAAGCTGTAAGGAAGGGG + Intergenic
925558885 2:5166221-5166243 TTGTATCAGGTGGAAGGAAGGGG - Intergenic
926369983 2:12169896-12169918 CAGTGACAGCAGGAAGGAAGGGG + Intergenic
927062014 2:19432091-19432113 CTTTATCAGCAGCATGGAAATGG + Intergenic
927480876 2:23452961-23452983 CAGTCCCAGCATAAAGGAAGTGG - Intronic
928473795 2:31602884-31602906 TTGTATCAGATGTAAGGAAGGGG - Intergenic
928582663 2:32724819-32724841 CTGTATCAGCAGCATGAAAATGG - Intronic
929062457 2:37937074-37937096 TTGTATCAGGTGTAAGGAAGGGG + Intronic
929112325 2:38415340-38415362 CTGTTCAAGCATAAAGGAAGAGG + Intergenic
929424038 2:41825976-41825998 CTGTCCCAGCTGAAAGGAAATGG + Intergenic
929925967 2:46209370-46209392 CTGTATACGCTGAAAGGTAGGGG + Intergenic
930254845 2:49078092-49078114 CTTTATCAGCAGCATGAAAGTGG - Intronic
930455325 2:51601166-51601188 TTGTATAAGCTGTAAGGAAGGGG + Intergenic
931091980 2:58896122-58896144 CTGCATCAGCCGAGAGGAAAGGG + Intergenic
931905386 2:66837110-66837132 ATGTAACAGCAAAAATGAAGTGG + Intergenic
932073818 2:68644898-68644920 CTCTGTCAGCTGCAAGGAAGGGG - Intronic
932908279 2:75778202-75778224 TTGTATAAGGTGAAAGGAAGGGG - Intergenic
933408306 2:81891292-81891314 CTTTTTCAGCATAAATGAAGTGG + Intergenic
933550115 2:83765842-83765864 CTGTATAAGGTGTAAGGAAGGGG + Intergenic
934096745 2:88613949-88613971 CTCTATTCGTAGAAAGGAAGAGG + Intronic
934317410 2:91936763-91936785 CTTTATCAGCAGAATGAAAACGG + Intergenic
935029049 2:99304459-99304481 CTTTATCAGCAGCATGAAAGTGG + Intronic
936166700 2:110127010-110127032 TTGTTCCAGAAGAAAGGAAGTGG - Intronic
937318287 2:120945870-120945892 CCAGAGCAGCAGAAAGGAAGTGG + Intronic
938213692 2:129490306-129490328 CTGTGTCAGCAAAATGGATGTGG + Intergenic
938678780 2:133667354-133667376 CTGAATCAGCAGAGATGGAGTGG - Intergenic
939436530 2:142184341-142184363 CTTTATCAGCAGCATGGAAATGG - Intergenic
939475436 2:142680701-142680723 CAGTTGCAGGAGAAAGGAAGGGG - Intergenic
939748153 2:146003978-146004000 CTTTATCAGAAGAAAGGACAGGG - Intergenic
940094553 2:149959567-149959589 CTGTATAAGATGTAAGGAAGGGG + Intergenic
940421163 2:153479950-153479972 CTGTTACAGCTGAAAGAAAGAGG - Intergenic
942407718 2:175673608-175673630 CTGTATAAGGTGTAAGGAAGGGG - Intergenic
943697918 2:190956294-190956316 TTGTATAAGGTGAAAGGAAGGGG + Intronic
944009993 2:194964086-194964108 CTTTATCAGCAGCATGGAAAAGG - Intergenic
944335615 2:198530354-198530376 CTGTATAAGATGAAAGGAAGGGG - Intronic
944338398 2:198565481-198565503 ATGGATCAGCCGAAAGAAAGGGG - Intronic
945678741 2:212887420-212887442 TTGTATAAGCTGTAAGGAAGGGG - Intergenic
946450879 2:219778071-219778093 TTGTATCAGGAGAAAGGAATGGG + Intergenic
947248723 2:228078156-228078178 CTGTATCAGCAGCATGAAAATGG + Intronic
947648011 2:231758959-231758981 CTATACCACCAGACAGGAAGGGG + Intronic
947818115 2:233051655-233051677 CTGAAGAAGCAGAGAGGAAGAGG + Intergenic
948182386 2:235992464-235992486 CTGAATCCTCAGAAAGGAATGGG - Intronic
948444177 2:238019380-238019402 CTGTATCAAAAAAAAGGCAGGGG - Intronic
1169034478 20:2438375-2438397 CTGTATCAGCAGAAATCACCTGG - Intergenic
1169070070 20:2720739-2720761 TTGGATCAACAGAAAGGAAATGG - Intronic
1170052930 20:12166514-12166536 CAGTTTCTGCAGCAAGGAAGAGG + Intergenic
1170228923 20:14023573-14023595 CTGTATAAGGTGTAAGGAAGGGG + Intronic
1172076085 20:32298683-32298705 CTGTCTCTGAAGAAGGGAAGGGG - Intronic
1172379938 20:34481524-34481546 CTTTATCAGCAGCAGGAAAGTGG - Intronic
1172638622 20:36427176-36427198 CTGTCTCAAAAGAAAGAAAGAGG + Intronic
1173186754 20:40846214-40846236 CTATCTCAGCAAAGAGGAAGAGG + Intergenic
1173479422 20:43387586-43387608 CGGAAGCAGCAGCAAGGAAGAGG + Intergenic
1173918251 20:46725582-46725604 CTGTACCAGCAGGGAGGAAGAGG - Exonic
1175041396 20:56054853-56054875 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
1175227193 20:57451453-57451475 CTGCCTCAGCAGCAAAGAAGGGG + Intergenic
1176161041 20:63648951-63648973 CTGCATCATCAGGAAAGAAGGGG + Intronic
1178020837 21:28406654-28406676 CTTTATTAGCAGCAAGGAAATGG - Intergenic
1178199352 21:30386470-30386492 CTGTATTCTAAGAAAGGAAGAGG + Intronic
1179255788 21:39714089-39714111 CTTTATCAGCAGAGAGGAGTAGG - Intergenic
1179310342 21:40189871-40189893 CTGTATCAGCAGCATGAAAACGG + Intronic
1183084475 22:35478112-35478134 CTGAATAAACAGGAAGGAAGGGG + Intergenic
1183619988 22:38966630-38966652 CTGTACCAGCAGACACGAATGGG - Intronic
1184008168 22:41725944-41725966 CTCTTTCTGCAGCAAGGAAGAGG + Intronic
1184048597 22:41988032-41988054 CTGTATCAGCAAAGAGGACTTGG + Intronic
1185114382 22:48923262-48923284 CTTTATCCGCAGAAAGGAGTTGG + Intergenic
949163123 3:906049-906071 CACTATCACCAGAAAGGATGGGG + Intergenic
949397938 3:3634956-3634978 CAGTGTTAGTAGAAAGGAAGGGG - Intergenic
949449775 3:4173025-4173047 CTGTATAAGGTGTAAGGAAGGGG + Intronic
949980959 3:9501439-9501461 ATGTTCCAGCAGAGAGGAAGAGG + Exonic
950364963 3:12476447-12476469 CTTAATCAGCAAAAAGGAGGAGG - Intergenic
951675999 3:25242478-25242500 TTGTATAAGGTGAAAGGAAGGGG + Intronic
952860118 3:37806160-37806182 CTGTCTCAGCAGGAAGGAGTTGG - Intronic
953318919 3:41954722-41954744 CTGTATGAGGAGATCGGAAGAGG - Exonic
953589379 3:44236865-44236887 CTGAATAAGGAGAAAGGAGGGGG - Intergenic
954531523 3:51324885-51324907 CTGTATAAGGTGTAAGGAAGGGG - Intronic
955970530 3:64434549-64434571 CTATATCAGCAGCATGGAAATGG + Intronic
956259366 3:67321219-67321241 TTGGACCATCAGAAAGGAAGAGG - Intergenic
956630951 3:71316110-71316132 CTGGATCTGCAGAAGAGAAGGGG - Intronic
957253435 3:77805127-77805149 CTCTACCAGCAGAAAATAAGAGG - Intergenic
957857932 3:85903097-85903119 CAATAACAGCACAAAGGAAGTGG - Intronic
958872254 3:99574270-99574292 TTGTATATGCTGAAAGGAAGGGG - Intergenic
959166935 3:102792242-102792264 CTCTATCAGCTGAAAGACAGAGG - Intergenic
959203406 3:103276775-103276797 TTGTATCAGGTGTAAGGAAGGGG + Intergenic
959778107 3:110194084-110194106 TTGTATCATTAGAAAGGAAGAGG - Intergenic
959834182 3:110898970-110898992 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
960078657 3:113516506-113516528 TTGTAACAGCAGAAAGCAAGGGG - Intergenic
960224449 3:115152911-115152933 CTTTATCAGCAGCATGGAAACGG + Intergenic
960438352 3:117655530-117655552 ATGGATGAGCAGGAAGGAAGTGG + Intergenic
960779910 3:121308603-121308625 CAGTAAGAGCATAAAGGAAGTGG + Intronic
961073581 3:123961334-123961356 CTGGAGCAGGAGAAAGGGAGTGG - Exonic
963100236 3:141594973-141594995 CAGTAACAGCACAAAGGAAGGGG + Intronic
963252315 3:143114775-143114797 CTGTCTCAGAAAAAAGGAGGAGG - Intergenic
963267146 3:143250745-143250767 CTTTATCAGCAGCATGGAAATGG + Intergenic
964454863 3:156852004-156852026 CTTTATCTGAAGGAAGGAAGAGG + Intronic
964495547 3:157286044-157286066 CTTGAGCAGCAGAAAGGAAGTGG + Intronic
965664831 3:171082177-171082199 CTGTTTCTGCAGAAATGAGGTGG + Intronic
965985379 3:174746896-174746918 TTGTATAAGCTGTAAGGAAGGGG - Intronic
966057598 3:175714850-175714872 CTGTATAAGGTGTAAGGAAGGGG - Intronic
966512037 3:180775408-180775430 CTTTATCAGCAGCATGGAAATGG - Intronic
967571989 3:191040420-191040442 CTGTAACAGCAGAAATGATTAGG - Intergenic
967854743 3:194108233-194108255 TTGGGTCAGCAGAAAGCAAGAGG - Intergenic
967946492 3:194808022-194808044 CTCTACCCGCAGAAAGGCAGGGG - Intergenic
968295302 3:197571730-197571752 CTTTATCAGCAATAAGGAAATGG + Intronic
969624640 4:8296197-8296219 CTGTCTCAGGAGAAAGAGAGAGG - Intronic
970017302 4:11526310-11526332 ATGTATGAGGAGAGAGGAAGTGG - Intergenic
970054904 4:11960432-11960454 CTGTATAAGGTGTAAGGAAGGGG + Intergenic
970533574 4:17006453-17006475 TTGATTCAGCAGAAAGGCAGTGG + Intergenic
970815056 4:20145351-20145373 TTGTATAAGGTGAAAGGAAGGGG - Intergenic
971668790 4:29528986-29529008 CTTTATCAGCAGCAAGAAAATGG + Intergenic
971742089 4:30534086-30534108 CTTTATCAGCAGCATGAAAGTGG + Intergenic
972948529 4:44288805-44288827 GTATATATGCAGAAAGGAAGAGG - Intronic
973213453 4:47642003-47642025 GTGAACCATCAGAAAGGAAGAGG + Exonic
974772324 4:66432993-66433015 CTTTATCAGCAGCATGGAAACGG - Intergenic
974779193 4:66529186-66529208 CTGTAAAAGCAGACAGGAGGAGG + Intergenic
974964314 4:68741651-68741673 CTGTATGTGGTGAAAGGAAGAGG - Intergenic
975212511 4:71717599-71717621 TTGTATCAGGTGTAAGGAAGGGG + Intergenic
975391483 4:73823040-73823062 TTGAATCAGCAGAAAGAAATTGG + Intergenic
976607926 4:86999948-86999970 CTGTAGTAACAGAAAGGAAAGGG + Intronic
977289530 4:95149034-95149056 CTGCATCAACAGAAATAAAGGGG - Intronic
977664674 4:99632255-99632277 TTGTTTCGGCAGAAGGGAAGGGG - Intergenic
977786470 4:101040883-101040905 CTGTATAAATAGAAAAGAAGGGG - Intronic
977949650 4:102955383-102955405 CTTTATCAGCAGAATGAAAACGG + Intronic
978643050 4:110893802-110893824 GTGTATTAGCAGAAGGGAAGGGG + Intergenic
978900801 4:113947473-113947495 CTGTTTCAAAAGAAAGAAAGAGG + Intronic
979327711 4:119399111-119399133 CTTTATCAGCAGCATGGAAATGG - Intergenic
979406023 4:120311314-120311336 CTTTATCAGCAGAATGAAAACGG - Intergenic
979464493 4:121021246-121021268 CTTTATCAGCAGCATGAAAGTGG - Intergenic
979493464 4:121357456-121357478 TTGGATCAGCAGATAGGGAGTGG - Intronic
982090558 4:151876603-151876625 CTGAAACAGAAGCAAGGAAGTGG - Intergenic
982478315 4:155878848-155878870 CTGTAAAAGCAGCCAGGAAGGGG - Intronic
982601432 4:157455622-157455644 TTGTATCAGGTGTAAGGAAGGGG + Intergenic
982625035 4:157755992-157756014 CTGTATAAGGTGTAAGGAAGGGG + Intergenic
983245462 4:165282833-165282855 CTTTATCAGCAGCATGGAAATGG - Intronic
983519647 4:168694389-168694411 CTCTCTCAGAGGAAAGGAAGAGG - Intronic
983809181 4:172037159-172037181 ATGTACTAGCAGAAAGTAAGGGG - Intronic
983941675 4:173539338-173539360 TTGTATCAGCAGAACAGTAGTGG + Intergenic
984724091 4:183003351-183003373 CTGGGTCATCAGAAAGGAAAGGG + Intergenic
985362054 4:189186035-189186057 TTGTATCTGCAGAAATGATGAGG + Intergenic
985839130 5:2292490-2292512 TTGTATATGCTGAAAGGAAGGGG - Intergenic
986251579 5:6062969-6062991 CTTTATCAGCAGCATGGAAAAGG + Intergenic
986287348 5:6369744-6369766 CTGTGTCTGCAGGAAGAAAGGGG + Intergenic
986918176 5:12650686-12650708 GGGTATAAGGAGAAAGGAAGTGG - Intergenic
987225252 5:15833146-15833168 CTTTATCAGCAGAATGAAAGCGG + Intronic
987236788 5:15950644-15950666 CTGTTTCAGCACAAAGTCAGAGG - Intergenic
987892155 5:23893104-23893126 TTGTATCAGGTGTAAGGAAGGGG + Intergenic
987972466 5:24966002-24966024 TTGTATAAGCTGTAAGGAAGGGG + Intergenic
988172825 5:27681887-27681909 CTTTATCAGCAGCAAGAAAATGG - Intergenic
988898113 5:35700209-35700231 CTTTATCAGCAGCATGGAAAGGG + Intronic
988987638 5:36636414-36636436 CTCTATTAGCAGAGAAGAAGGGG + Intronic
989148724 5:38276007-38276029 CTTTATCAGCAGCAAGAAAATGG - Intronic
990488490 5:56281567-56281589 CTTTATCAGCAGCATGGAAAGGG - Intergenic
991046926 5:62232481-62232503 AAGTATCAGCAGAAATTAAGAGG + Intergenic
991047759 5:62240677-62240699 CTGAGGCAGCAGACAGGAAGGGG - Intergenic
992122692 5:73610928-73610950 CTGTATCAGCAGCATGAAAACGG - Intergenic
992183689 5:74222849-74222871 CTGTGGCAGCAAAGAGGAAGTGG + Intergenic
993748476 5:91633025-91633047 CTGTGTCAACAGAAGGAAAGTGG + Intergenic
994088703 5:95788599-95788621 CTGTGACAGCAGACAGGATGAGG - Intronic
994313900 5:98309807-98309829 CTGTGTCGTCAGAGAGGAAGAGG - Intergenic
994383033 5:99094329-99094351 CTGTGTCAGAAGAGAAGAAGGGG + Intergenic
994642396 5:102426087-102426109 TTGTATAAGCTGTAAGGAAGGGG - Intronic
995055123 5:107750761-107750783 TTGTAGAAGAAGAAAGGAAGGGG - Intergenic
995078311 5:108014737-108014759 CTTTATCAGCAGCATGAAAGCGG - Intronic
995538941 5:113165559-113165581 CTGTAACGGCAGAAGGGTAGAGG - Intronic
995660888 5:114481853-114481875 TTGTATAAGCTGTAAGGAAGGGG - Intronic
996036700 5:118766394-118766416 CTGTATATGGAGTAAGGAAGGGG - Intergenic
996280256 5:121721545-121721567 CTGTATAAGATGTAAGGAAGGGG + Intergenic
996407337 5:123118543-123118565 CTTTATCAGCCCAAATGAAGGGG - Intronic
997016103 5:129937343-129937365 CTATATCAGGAGACAGCAAGGGG + Intronic
999726078 5:154439197-154439219 CTGTAACTCCAGAAAGGAAATGG - Intergenic
1000201060 5:159011544-159011566 CTGTTTCAGCAGAATGGAAGCGG + Intronic
1000417417 5:160997567-160997589 TTGTATAAGCTGTAAGGAAGGGG + Intergenic
1000584342 5:163078169-163078191 TTGTATAAGGTGAAAGGAAGGGG - Intergenic
1000859817 5:166443898-166443920 CAGTAGCAGCAGAAGGCAAGAGG - Intergenic
1001708764 5:173761250-173761272 ATCTCACAGCAGAAAGGAAGAGG - Intergenic
1002091282 5:176808044-176808066 CTGTAGCAGGAGAAAAGATGAGG + Intergenic
1003317799 6:5027571-5027593 TTTTATCAGCAGAAAGAAAAAGG - Intergenic
1003892270 6:10574129-10574151 CTGTAGAAGAAGAAAGGAAACGG + Intronic
1003952283 6:11127464-11127486 CTTTATCAGCAGCATGAAAGTGG - Intronic
1004609328 6:17224423-17224445 CTTTATCAGCAGCATGGAAATGG - Intergenic
1006526888 6:34613965-34613987 CTATAGTAGCAGAAAGAAAGTGG + Intronic
1007570072 6:42883445-42883467 CTGTAGCAGAAGAAAGGAAAAGG + Exonic
1008357482 6:50571519-50571541 CTGTATAAGGTGTAAGGAAGGGG + Intergenic
1008565244 6:52761774-52761796 CTATATCTGCAGAGAGGGAGGGG + Intronic
1008669412 6:53751934-53751956 CTTTATTAGCAGAAGGGAGGAGG + Intergenic
1008930334 6:56932391-56932413 CTTTATCAGCAGAATGGAAGTGG + Intronic
1009577759 6:65488945-65488967 TTGTATAAGGAGTAAGGAAGGGG - Intronic
1009755770 6:67938169-67938191 CTGTGTCAGAAGAAAGCAAGTGG - Intergenic
1010305519 6:74316936-74316958 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1010474374 6:76267935-76267957 CTGTATCAGCAGCATGAAAATGG + Intergenic
1010521663 6:76845660-76845682 CTGTATAAGGTGTAAGGAAGGGG + Intergenic
1011072854 6:83404679-83404701 TTGTATAAGCTGTAAGGAAGGGG + Intronic
1011393649 6:86882105-86882127 TTGTATAAGGAGTAAGGAAGGGG + Intergenic
1012194277 6:96319102-96319124 CTTTATCAGCAGAATGAAAATGG - Intergenic
1012260349 6:97081200-97081222 TGGTATCTGCAGGAAGGAAGTGG + Intronic
1012707346 6:102548323-102548345 CTTTATCAGCAGCGAGGAAATGG + Intergenic
1013148187 6:107415903-107415925 TTGTTTCAGAAGAAAGGAACAGG + Intronic
1013292240 6:108729455-108729477 CTGTGTCAGCTGAAAAGAATGGG - Intergenic
1013912886 6:115299284-115299306 TTGTATCAGGTGTAAGGAAGGGG - Intergenic
1013930165 6:115521061-115521083 TTGTATAAGGTGAAAGGAAGGGG - Intergenic
1014327706 6:120019254-120019276 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1014611518 6:123553556-123553578 CTTTATCAGCAGTATGGAAACGG - Intronic
1014715645 6:124861863-124861885 CTGTATCAGCAGCATGAAAATGG - Intergenic
1015754534 6:136594250-136594272 CTGCTACAGCAGAAAGGAAATGG + Intronic
1016437437 6:144051590-144051612 CTTTATCAGCAGCATGAAAGAGG - Intronic
1016864138 6:148748479-148748501 CTTTAGCAGAAGTAAGGAAGGGG + Intronic
1017911469 6:158796462-158796484 CAATATCAGCAGCAAGGGAGAGG - Intronic
1018031902 6:159848056-159848078 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1018101472 6:160444735-160444757 CTCTACCAGAAGTAAGGAAGTGG - Intronic
1018392683 6:163352466-163352488 GTGTGAGAGCAGAAAGGAAGAGG - Intergenic
1018485936 6:164241220-164241242 CTTTATCAGCAGAATGAAAGTGG - Intergenic
1019019792 6:168908768-168908790 CTATATTTGCAGAAAAGAAGTGG - Intergenic
1019658085 7:2208655-2208677 CTGTTTCAGTAGAATGAAAGGGG - Intronic
1019920759 7:4161828-4161850 CTGTATCAGGACAGAGGACGTGG - Exonic
1020693384 7:11386883-11386905 CTGTATAAGGTGTAAGGAAGGGG + Intronic
1020694549 7:11397379-11397401 CTGTATAAGGTGTAAGGAAGGGG - Intronic
1022600592 7:31755348-31755370 CTCTATCAGCTGAAGGGGAGGGG + Intronic
1022715646 7:32895540-32895562 TAGTATGAGCAGAAAGGAAAAGG + Intergenic
1023016734 7:35975957-35975979 CTTTATTAGCAGAAAGACAGTGG - Intergenic
1023250781 7:38258737-38258759 ATGTGCAAGCAGAAAGGAAGGGG + Intergenic
1023252326 7:38278361-38278383 ATGTGCAAGCAGAAAGGAAGGGG + Intergenic
1023509732 7:40939043-40939065 CTTTATCAGCAGCATGGAAATGG - Intergenic
1023894803 7:44424112-44424134 TTGTATCAGGTGTAAGGAAGGGG - Intronic
1023979270 7:45057611-45057633 TTATATGAGCAGATAGGAAGAGG + Intronic
1024424859 7:49213511-49213533 CTTTATCAGCAGAGTGAAAGTGG - Intergenic
1026797458 7:73375626-73375648 CTGAATCAGCAGAGAGGAGAAGG + Intergenic
1026849745 7:73717346-73717368 CAGAATCCCCAGAAAGGAAGAGG - Intronic
1027223121 7:76226528-76226550 CTGTATCAGCAGAAAGGAAGTGG + Intronic
1027557328 7:79681904-79681926 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1027979519 7:85200111-85200133 CTTTATCAGCAGCATGGAAGTGG + Intergenic
1028301996 7:89211537-89211559 TTGTATAAGGTGAAAGGAAGGGG + Intronic
1028544166 7:91979166-91979188 CTGTATCAGCAGCATGAAAATGG - Intronic
1028795032 7:94893041-94893063 CTTTATCAGCAGCATGAAAGTGG + Intergenic
1029000657 7:97151311-97151333 CTGTAGCTGCAGAAAGAAATAGG + Intronic
1029876953 7:103764464-103764486 TTGTATAAGCACCAAGGAAGTGG + Intronic
1030195716 7:106851640-106851662 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1030724220 7:112906397-112906419 CTGTATAAACAGAAGGGAAGGGG + Intronic
1030811201 7:113974385-113974407 CAGTATCAGCATACAGTAAGAGG + Intronic
1031169140 7:118270038-118270060 TTGTATCAGGTGTAAGGAAGGGG + Intergenic
1031622993 7:123958223-123958245 CTTTATCAGGCCAAAGGAAGTGG - Intronic
1033410002 7:141108828-141108850 CTTTATCAGCAGCAAGAAAACGG - Intronic
1033495487 7:141889697-141889719 CTGTATCAATAAAAAGAAAGTGG + Intergenic
1033845578 7:145427910-145427932 GTGTATCAGCAGAAACCAAGTGG + Intergenic
1034012844 7:147548778-147548800 CTGTATAAGGTGTAAGGAAGGGG + Intronic
1035925177 8:3720496-3720518 CTATGGCAGCAGAAAGGAAGTGG - Intronic
1035938419 8:3868454-3868476 CTGCATCAGCCAAAAGGAAGGGG + Intronic
1037641894 8:20752140-20752162 AATGATCAGCAGAAAGGAAGTGG + Intergenic
1037763959 8:21760329-21760351 CTGAAGCAGCAGAAAGCTAGTGG + Intronic
1038518671 8:28210018-28210040 TTGTATAAGCTGTAAGGAAGGGG - Intergenic
1039662047 8:39478386-39478408 CATTCTCTGCAGAAAGGAAGAGG - Intergenic
1040611255 8:48984367-48984389 CTATATCAGCAGGAAGCTAGTGG + Intergenic
1041417574 8:57628877-57628899 CAGGATAAGCAGAAGGGAAGAGG - Intergenic
1041948148 8:63470147-63470169 CAGTCTCAGCAGAAAGAGAGAGG + Intergenic
1042111848 8:65389385-65389407 TTTTATCAGCAAAAAGGGAGAGG + Intergenic
1042240814 8:66662447-66662469 CTGTATCTGCAGAAATGGAATGG - Intronic
1043730936 8:83680508-83680530 CTGTATGAACAGAAAGAAAAAGG + Intergenic
1044283220 8:90380386-90380408 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
1044555688 8:93559481-93559503 CCGGATTAGGAGAAAGGAAGAGG + Intergenic
1044760547 8:95513461-95513483 CTTTATCAGCAGCATGAAAGTGG - Intergenic
1045356808 8:101396653-101396675 CTGTAACAGCAGAAAGGACAGGG + Intergenic
1045533001 8:103002027-103002049 CCATAGAAGCAGAAAGGAAGGGG + Intergenic
1045644245 8:104284665-104284687 CTGGATCAGAAGAAAAGAACTGG + Intergenic
1045701009 8:104866105-104866127 CTGTATCACCAGAGAAGAAGGGG + Intronic
1046726975 8:117686499-117686521 CTGCTACCGCAGAAAGGAAGTGG + Intergenic
1047097540 8:121640607-121640629 CTGTGTCCCCAGAAAGGCAGCGG + Intronic
1047584149 8:126251167-126251189 CTGTCTCAGAAAAAAGGAGGGGG - Intergenic
1047621686 8:126613942-126613964 CTTTATCAGCAGAATGAAAATGG + Intergenic
1047819469 8:128502781-128502803 CTGGTTCAGCAGGGAGGAAGGGG - Intergenic
1048267191 8:132998151-132998173 CTGTATTAGGAGAAATCAAGAGG + Intronic
1050661842 9:7891469-7891491 CTTTATCAGCAGAATGAAAATGG - Intergenic
1051718970 9:20015682-20015704 CTGTATGAGAAGACAGAAAGTGG - Intergenic
1053463826 9:38290541-38290563 CTGAAACAGCAGAGAGGCAGAGG - Intergenic
1055083279 9:72289339-72289361 CTTTATCAGCAGTATGAAAGTGG - Intergenic
1055106828 9:72522045-72522067 CTGTAGCAGTAGAAAAGTAGAGG - Intronic
1055395675 9:75871804-75871826 CTGTATCAGCATCTAGAAAGAGG - Intergenic
1055809160 9:80131541-80131563 CTGTCTCAGAAGAAAGGGGGTGG + Intergenic
1056887931 9:90461711-90461733 TTGTATAAGAAGTAAGGAAGGGG - Intergenic
1058819693 9:108718424-108718446 CTGTATAAGGTGTAAGGAAGGGG - Intergenic
1059960782 9:119562538-119562560 CTGTCTAAGAAGAAAGGCAGAGG + Intergenic
1060260724 9:122071519-122071541 CTCCCTCAGCAGAAAGGAGGAGG + Intronic
1060870940 9:127039689-127039711 ATGAGTCAGCAGAAAGGAAAGGG + Intronic
1060871049 9:127040395-127040417 CTGTCTCAGAAGAAAAGAAAAGG + Intronic
1060976873 9:127770252-127770274 CTGGAGCAGGAGGAAGGAAGGGG - Intronic
1061365157 9:130168839-130168861 CTGTATCATCAGCCAGGAGGTGG - Intergenic
1061586136 9:131570031-131570053 GTGGACCAGCAGAAAGGAAAAGG - Intergenic
1186061631 X:5714459-5714481 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
1187320908 X:18236904-18236926 CTGAATCTTCAGAATGGAAGTGG + Intergenic
1187370268 X:18699667-18699689 CTTCATCAGCAGAAAGGGAAAGG - Intronic
1187556308 X:20355584-20355606 CTGCAGCAGCATTAAGGAAGCGG - Intergenic
1188642516 X:32523774-32523796 CTGTATAAGGAGGAAGGAAAGGG + Intronic
1188892617 X:35629454-35629476 TTGTATAAGGTGAAAGGAAGGGG + Intergenic
1189192390 X:39121867-39121889 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1189464607 X:41268882-41268904 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1189744973 X:44159658-44159680 CTTTATCAGCAGAAATGATGAGG + Intronic
1190729115 X:53213087-53213109 CTGTCTCAGAAGATAGGATGTGG + Intronic
1191026684 X:55921212-55921234 TTGTATCAGGTGTAAGGAAGGGG + Intergenic
1191736005 X:64388409-64388431 ATGTAACAGGAGGAAGGAAGGGG + Intronic
1191857989 X:65643063-65643085 CTGACTCAGAAGAAGGGAAGAGG - Intronic
1192000563 X:67145944-67145966 CTGTATAAGGTGCAAGGAAGGGG + Intergenic
1192305228 X:69952225-69952247 CTTTATCAGCAGAATGAAAATGG - Intronic
1193195562 X:78627468-78627490 CTGTATAAGGTGTAAGGAAGGGG + Intergenic
1193279076 X:79626305-79626327 CTGTGACAGCAGCCAGGAAGGGG - Intergenic
1193320282 X:80113973-80113995 CTTTATCAGCAGCAAGAAAGTGG + Intergenic
1193438373 X:81508760-81508782 TTGTATAAGGAGTAAGGAAGGGG - Intergenic
1193449341 X:81646401-81646423 CTTTATCAGCAGCATGAAAGCGG + Intergenic
1194164484 X:90497996-90498018 CTGTATAAGGTGTAAGGAAGGGG + Intergenic
1194199748 X:90940098-90940120 TTGTATATGCAGTAAGGAAGGGG + Intergenic
1194300746 X:92182832-92182854 CTTTATCAGCAGCATGAAAGTGG + Intronic
1194404348 X:93476436-93476458 TTGTATCAGGTGTAAGGAAGGGG - Intergenic
1194575782 X:95612849-95612871 CTGTATAAGATGTAAGGAAGGGG + Intergenic
1194944304 X:100049336-100049358 CTGTATCACCAGAAAAGCAAGGG - Intergenic
1195376059 X:104229360-104229382 GTGTAGCTGCAGAAAGGAGGAGG - Intergenic
1196409796 X:115405934-115405956 CTCTATGAGCAGAGAGAAAGAGG - Intergenic
1196561112 X:117149662-117149684 CTGTATGTGGTGAAAGGAAGAGG + Intergenic
1197680319 X:129375846-129375868 TTGTATAAGGTGAAAGGAAGGGG - Intergenic
1197941788 X:131797817-131797839 CTGTACCAGGAGAAGGGAACTGG - Intergenic
1197994233 X:132354823-132354845 ATGTGTAAGCAGAAAGGAAAGGG + Intergenic
1199550999 X:149061239-149061261 CTGAGTCAGAAGAAAGGAACTGG + Intergenic
1199606906 X:149585396-149585418 CTGGTTCAGCAAAATGGAAGGGG - Intronic
1199632217 X:149783972-149783994 CTGGTTCAGCAAAATGGAAGGGG + Intronic
1200510743 Y:4075792-4075814 CTGTATAAGGTGTAAGGAAGGGG + Intergenic
1200545739 Y:4516514-4516536 TTGTATATGCAGTAAGGAAGGGG + Intergenic
1201518710 Y:14847984-14848006 TGGACTCAGCAGAAAGGAAGTGG + Intergenic