ID: 1027224521 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:76235418-76235440 |
Sequence | GGGGCTATTAGGGCGGAGTC GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 64 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 58} |
Found 0 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
---|
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1027224521 | Original CRISPR | GGGGCTATTAGGGCGGAGTC GGG | Intronic | ||