ID: 1027225932

View in Genome Browser
Species Human (GRCh38)
Location 7:76243706-76243728
Sequence GGGTGGGAAGAGATGGCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 296}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027225932_1027225948 21 Left 1027225932 7:76243706-76243728 CCTTAGGCCATCTCTTCCCACCC 0: 1
1: 0
2: 1
3: 26
4: 296
Right 1027225948 7:76243750-76243772 CAGTCTCTGTCTCCCTCTGTGGG 0: 1
1: 0
2: 6
3: 53
4: 447
1027225932_1027225949 22 Left 1027225932 7:76243706-76243728 CCTTAGGCCATCTCTTCCCACCC 0: 1
1: 0
2: 1
3: 26
4: 296
Right 1027225949 7:76243751-76243773 AGTCTCTGTCTCCCTCTGTGGGG 0: 1
1: 0
2: 3
3: 58
4: 431
1027225932_1027225947 20 Left 1027225932 7:76243706-76243728 CCTTAGGCCATCTCTTCCCACCC 0: 1
1: 0
2: 1
3: 26
4: 296
Right 1027225947 7:76243749-76243771 CCAGTCTCTGTCTCCCTCTGTGG 0: 1
1: 1
2: 2
3: 56
4: 374
1027225932_1027225936 -10 Left 1027225932 7:76243706-76243728 CCTTAGGCCATCTCTTCCCACCC 0: 1
1: 0
2: 1
3: 26
4: 296
Right 1027225936 7:76243719-76243741 CTTCCCACCCACCTGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027225932 Original CRISPR GGGTGGGAAGAGATGGCCTA AGG (reversed) Intronic
900714139 1:4133247-4133269 GGGAGGGAAGAGGAGGCCTGGGG + Intergenic
901895463 1:12308083-12308105 GCGTGGGGAGGGATTGCCTATGG + Intronic
902805643 1:18859661-18859683 GGCTGGGAAGTGATGGTCTCAGG + Exonic
903189341 1:21648065-21648087 AGCTGGGAAGGGAGGGCCTAGGG + Intronic
903925410 1:26827537-26827559 GGTTGGCAAGAGATGGTCCAGGG - Intronic
904413233 1:30337633-30337655 GGCTGGGAAGGGCTGGCCTGGGG - Intergenic
904743336 1:32695390-32695412 AGCTGGAGAGAGATGGCCTAAGG - Exonic
904747219 1:32718644-32718666 GAGTGGGAAGAGCAGGCCTCTGG + Intergenic
904800169 1:33086903-33086925 GGCTGGGAAGCAATGGCTTAAGG - Intronic
905297414 1:36962961-36962983 GGGTGGGTAGAGGTGGCCAAGGG + Intronic
905746853 1:40425441-40425463 AGATGGGAAGAGCTGACCTAGGG + Intergenic
905775419 1:40664881-40664903 GGGTGGGAAGAGGGGGCTTTGGG - Intronic
908510183 1:64844956-64844978 GGGTAGGAAGAGATGACCTGAGG - Intronic
911754428 1:101536701-101536723 GGGTGGGAAGTGATTGGATATGG + Intergenic
913607310 1:120477896-120477918 GTGTGGGAAGAGAGGAACTAGGG + Intergenic
914503404 1:148266657-148266679 GGGTGGGAAAAGAGGAACTAGGG + Intergenic
914510359 1:148327270-148327292 GGGTGGGAAAAGAGGAACTAGGG - Intergenic
914938440 1:152001054-152001076 GGGTGGGAGGAAGTGTCCTAAGG + Intergenic
915467236 1:156104811-156104833 GGGAGAGAAGAGAGGGCATATGG + Intronic
915489259 1:156242354-156242376 GGGTGAGAAGAGGTGGGCCATGG - Intronic
916269077 1:162920498-162920520 GTCAGGGAAGAGAGGGCCTAGGG + Intergenic
919823176 1:201485506-201485528 TGCTGGGAGGACATGGCCTATGG + Intronic
921014736 1:211178651-211178673 AGGTGGGAAAAGATGTCATAGGG + Intergenic
923833409 1:237582693-237582715 GGGTGCTAAGATATGGCCTCTGG + Intronic
924282563 1:242452863-242452885 GTGTGGGAAGATAGGACCTAGGG - Intronic
924456037 1:244219596-244219618 GAGTGGGCAGGGATGGGCTAGGG + Intergenic
924710080 1:246524121-246524143 GGGTGGGTAGTGCTGGCCTCTGG - Intergenic
1062768849 10:84313-84335 GGGTGGGATCAGAGGGCCTGTGG + Intergenic
1066122672 10:32305213-32305235 GGTTGGCAAGCTATGGCCTATGG + Intronic
1066526721 10:36288221-36288243 GGGTGGGTGGAGATGGCTAATGG - Intergenic
1066809425 10:39308016-39308038 AGGTGGCATGAGAAGGCCTATGG - Intergenic
1067243491 10:44516732-44516754 GGGTGGGGAGACACGGCCTTGGG - Intergenic
1069755450 10:70771967-70771989 AGGTGGGAGGAGCTGGCCTGCGG - Intronic
1070395324 10:76007251-76007273 GGGTGGGCAGAGAGGGGCCAAGG - Intronic
1071309205 10:84327713-84327735 AGAGGGGAAGAGATGGCCTCTGG + Intergenic
1072713738 10:97735731-97735753 GGGTAGGAAGAAAAGCCCTAAGG + Intergenic
1072743916 10:97926927-97926949 GGTTGGGCAGAGATGGGCAAGGG - Intronic
1072792728 10:98330021-98330043 GGCTTTAAAGAGATGGCCTAGGG + Intergenic
1073441206 10:103553790-103553812 GGGTGGGAAGAGAAAGCCAGCGG - Intronic
1074011530 10:109486452-109486474 TAGTAGGAAAAGATGGCCTAGGG - Intergenic
1076119035 10:127921420-127921442 GGGTGGGAAGAGGCGTCCTGTGG + Intronic
1076738331 10:132468508-132468530 GGGAGGGAGGAGATGGGATAGGG + Intergenic
1077173418 11:1178357-1178379 GGGTGGGAGGAGGCGGCCTAGGG + Intronic
1078790803 11:14540111-14540133 GGGTGGGTAGAGAGGGTCAAGGG - Intronic
1080697893 11:34619175-34619197 GGGTGGGAGTAGAAGGGCTAGGG - Intergenic
1083265061 11:61542788-61542810 GGGTGGGCAGAGCCGGCCTGGGG - Intronic
1083301050 11:61739767-61739789 GGCTGGGAGAAGATGGCCCAGGG + Intronic
1083711658 11:64553554-64553576 GGGTGGGGAGAGAAGGGCTTGGG - Intergenic
1083900683 11:65641862-65641884 GGCTGGGGAGAGATTCCCTATGG + Intronic
1083942972 11:65907829-65907851 GCCTGGGAAGGGATGGGCTAAGG + Intergenic
1084223085 11:67696861-67696883 GGGAGGGAAGAAGTGGCCTCAGG - Intergenic
1084603329 11:70159238-70159260 GTGGGGGAAGAGATGGGCCAGGG + Intronic
1085460507 11:76690278-76690300 GGATGGGAAGAGGTGGCCTTGGG + Intergenic
1086442653 11:86844431-86844453 GTGTAGTAAGTGATGGCCTATGG - Intronic
1089702332 11:120253005-120253027 GGGTGGTAAAAGATGGCTTATGG - Intronic
1089797796 11:120997139-120997161 TGGTGAGAAAAGATGGCCTGGGG + Intergenic
1090977486 11:131689803-131689825 GAGTGGGAGGAGGTGGCCTGGGG - Intronic
1091076573 11:132623658-132623680 GGGTGGGCAGGCATGGCCCAAGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1092988538 12:13871957-13871979 GGGTGGGAAGTGGAGGACTAGGG - Intronic
1093563969 12:20579606-20579628 GGCTGGAAAGAGGTGGTCTATGG - Intronic
1094441795 12:30485812-30485834 GGGTGGTCAGAGAAGGCCTCAGG - Intergenic
1096628964 12:52913201-52913223 GGGTGGGCAGGGCTGGCCTTGGG - Intronic
1096651608 12:53064671-53064693 GGGTGGGAAGCGAGGGCCAAAGG + Exonic
1097692060 12:62742815-62742837 GGGTGGGAGGTGATTGCCAATGG - Intronic
1098370069 12:69749337-69749359 GGGTGGGAGGAGATGGTTTCGGG - Intronic
1100963683 12:99990034-99990056 GGGGTGGAAGAGATGCCTTAAGG - Intergenic
1101018261 12:100524866-100524888 TGGTGGGAAGAAATGCCCTGGGG + Intronic
1101561068 12:105858808-105858830 TGGTGACAAGAGATGGCTTATGG + Intergenic
1102493472 12:113303486-113303508 GGGGAGGAAGAGATGGCCTGGGG - Intronic
1103971193 12:124673961-124673983 GGGTGGGGAGGGAGGGCATAGGG - Intergenic
1104740345 12:131167358-131167380 GGGTGGGGAGAGCTGACCTTAGG + Intergenic
1104770268 12:131357295-131357317 GGAGGTGAAGAGGTGGCCTATGG - Intergenic
1104791865 12:131488079-131488101 GGGTGGGGAGAGCTGACCTTAGG - Intergenic
1105584674 13:21732895-21732917 GAGTAAGAAGAGCTGGCCTAGGG + Intergenic
1108591725 13:51918398-51918420 GGGTGGAAAGACATGGCATCCGG + Intergenic
1108592683 13:51924782-51924804 GGAGGGGAAGAGAGGGCTTATGG - Intergenic
1110801996 13:79708891-79708913 GGGTTGGAAAACAAGGCCTATGG - Intergenic
1111793130 13:92883976-92883998 GGGTGGGAGGAGATGGGGCAGGG + Intergenic
1112334188 13:98500598-98500620 GGGTGGGAAGGTTTGACCTAAGG - Intronic
1113486508 13:110656540-110656562 GAGTGAGAAGTGATGGCCCATGG + Intronic
1114450657 14:22822837-22822859 GGGGTGGAAGAGACGGCCTTCGG - Intronic
1114525363 14:23364683-23364705 GGGCGGGAACAGATGGCCACTGG - Intronic
1115369374 14:32594669-32594691 GCCTGGGCAGAGATGGCCTGAGG + Intronic
1115370083 14:32603268-32603290 GGGTGGGATGAGTGGGGCTAGGG + Intronic
1115781360 14:36772422-36772444 GTGTGGGAAGAGATAGACTTTGG - Intronic
1116829690 14:49706103-49706125 GGGTGGGTAGGGATGGCTAATGG - Intronic
1117627019 14:57650748-57650770 GGGTGGGCAGGGATGGACCACGG - Intronic
1118350726 14:64971473-64971495 GGGGGGGAAGAGAGGACGTACGG - Intronic
1119542134 14:75446667-75446689 GAGTGGGGAGTGATGGCCAAGGG + Intronic
1121214378 14:92235903-92235925 GGGTGGGATGGGAAGACCTAAGG + Intergenic
1128096450 15:64960079-64960101 GGGTGGGAGGAGATGGCTGGTGG + Intergenic
1129172036 15:73813890-73813912 GGGTGGGAGGAGGTGGCCTGGGG + Intergenic
1129690376 15:77709976-77709998 GGATGGAAAGAGATGGCAAAAGG + Intronic
1130016941 15:80194922-80194944 GGATGGGAAGAGAGGGTCCAAGG + Intergenic
1130046138 15:80446486-80446508 GGGTGGCAAGAGATGTGCTAAGG - Intronic
1130244778 15:82236610-82236632 TGGTGGGAGGAGAGGGCCTTTGG - Intronic
1132893674 16:2217262-2217284 GTGTGGGAGAAGATGGCCCATGG - Intergenic
1132925159 16:2425472-2425494 GGGTGGGAAGGGCTGGCCTCCGG - Intergenic
1132992752 16:2805508-2805530 GGGTGGGAAGACATGGATTGGGG + Intergenic
1133211350 16:4264845-4264867 AGGTGGGAAGAGATGTCCATAGG + Intronic
1134782234 16:16908696-16908718 GGCTGGGAAGAGATAACCCAGGG + Intergenic
1134800675 16:17081690-17081712 AGGTGGGCAGAGAAGGCCTGAGG - Intergenic
1134803608 16:17106985-17107007 GGGTGGGAAAAGATGGGAAAAGG + Exonic
1135264875 16:21015647-21015669 GGGTGAGAAGAAGTGGCATATGG + Intronic
1135668596 16:24356093-24356115 GGGTAGGAAGAGATGGTAAAGGG - Intronic
1135735855 16:24931261-24931283 GGGTGGGAGGAGAGGGGCTTCGG + Exonic
1135929313 16:26723327-26723349 GGATGGGAAGAGAAGGCTGAAGG - Intergenic
1136136627 16:28260292-28260314 GGGTGGGGAGAGCTGGCTAAAGG - Intergenic
1136231332 16:28887344-28887366 GTGTGAGAAGAGATGGCGTGGGG + Intronic
1136556312 16:31009810-31009832 GGGAGGGAAGAGGTGGCCTCCGG - Intronic
1138949640 16:61896522-61896544 GGGAGGGAAGAGACAGGCTAAGG + Intronic
1139355311 16:66364131-66364153 GGGTGGGACGACAAGGCCTGGGG - Intergenic
1140126393 16:72122304-72122326 GGTTGGGAAGCGCTGTCCTAAGG + Intronic
1140246252 16:73252628-73252650 GGGTGGGAGGAGACGGGCTACGG + Intergenic
1140593221 16:76377614-76377636 GGGTGTGAAGAAATGACCTGTGG + Intronic
1141810386 16:86371889-86371911 GGGTTGAAAGAGATGGCATTTGG - Intergenic
1142138349 16:88461576-88461598 GGCTGGGAAGGGCTGTCCTAGGG + Intronic
1142146012 16:88493215-88493237 GGGTGGGGAGAGCTGTCCCACGG + Intronic
1142146064 16:88493375-88493397 GGGTGGGGAGAGCTGTCCCAGGG + Intronic
1142146106 16:88493495-88493517 GGGTGGGGAGAGCTGTCCCAGGG + Intronic
1142248241 16:88979456-88979478 GGGTGGGCAGAGGGGCCCTAAGG + Intergenic
1142455709 16:90220480-90220502 TGGTGGGCAGAGTTGGCCCAGGG - Intergenic
1142469725 17:156527-156549 GGGAGGGAAGAGATGACAGAAGG - Intronic
1144543702 17:16172118-16172140 GGGTGGGAACAGAAGGGGTACGG - Intronic
1145259558 17:21346707-21346729 GGGTGGGGGGAGGGGGCCTAAGG - Intergenic
1145317059 17:21741241-21741263 GGGTGGGGGGAGGGGGCCTAAGG + Intergenic
1145400740 17:22530301-22530323 TTGTGGCAAGAGATGGGCTAAGG - Intergenic
1146659934 17:34658957-34658979 GGGTAGGAAGAGGTGGCTCAGGG + Intergenic
1147591525 17:41686960-41686982 GGGTGGTCAGAGAAGGCCTCTGG - Intergenic
1147899398 17:43774160-43774182 GAGTGGGAAGAGATGGCTGCAGG + Intronic
1147948774 17:44095526-44095548 GGGTGGGAACAGGAGGCCTCGGG + Intronic
1148760183 17:49995641-49995663 TTGTGGAAAGAGATGGTCTAAGG + Intergenic
1148768775 17:50055253-50055275 GGGTGGGAAGAGGGAGCCTCTGG + Intergenic
1150724063 17:67637317-67637339 GGATGGGAAGAAAAGGCCCATGG - Intronic
1151205937 17:72506817-72506839 GGAAGGGAAGAGAAGGCCTTTGG + Intergenic
1151308622 17:73279943-73279965 TGGTGGGCAGAGGTGACCTATGG + Intergenic
1151344948 17:73495729-73495751 GAGTGGGAGGAGCTGGCCTCAGG + Intronic
1152022822 17:77789925-77789947 ATGTGGGAAGAGAGGGCCGATGG + Intergenic
1152330071 17:79667664-79667686 GGGTGGGAAGACAAGGCCCCCGG + Intergenic
1152545251 17:80997190-80997212 GGGAGGAAGGAGATGGCCTGTGG - Intronic
1152863840 17:82710673-82710695 TGGTGGGAAGAGATGGCCCCAGG + Intergenic
1153188227 18:2509011-2509033 GGGTGGGATGAGAAGGTCTTGGG - Intergenic
1153768254 18:8395300-8395322 AGGGAGGAAGAGATGGCCGATGG + Intronic
1153982240 18:10320385-10320407 AGGTGGGAAGTGATAGCCTCTGG + Intergenic
1155000651 18:21682722-21682744 GGGGGGGAAGACATGGTCTGAGG - Intronic
1155170265 18:23261912-23261934 TGGTGGTGAGAGATGGCATATGG - Intronic
1155985657 18:32227959-32227981 GGGTGGGAGGTGATGGATTACGG + Intronic
1157523311 18:48360486-48360508 GCGTGGGAAGAGATGCCCCTAGG + Intronic
1158437683 18:57444877-57444899 GGGTGGGAAGAGAGGGGGTCAGG + Intronic
1158518033 18:58146970-58146992 GGGTGGGATGAGCTGGCCTCAGG + Intronic
1160443600 18:78911598-78911620 GGGTGGGAACTGGAGGCCTAGGG - Intergenic
1160891845 19:1383178-1383200 GGGTGGGAAGAGGAGGCTTTGGG + Intergenic
1161553902 19:4929586-4929608 GGCTGGGCAGAAATGGCCAAGGG + Intronic
1162031804 19:7920734-7920756 GGACGGGAAGAGAAGACCTAGGG + Intronic
1162033907 19:7929148-7929170 GGGTGAGATGAGGTGGCCTGAGG + Intronic
1163258444 19:16172040-16172062 GGGTGTGAGGAGGTGGCCCAAGG - Intronic
1163359540 19:16837126-16837148 TGGTGGGGAGTGATGGCCTGAGG + Intronic
1164852897 19:31499801-31499823 GTGTGGGAAGAAAGGGCCTTGGG - Intergenic
1164889921 19:31814623-31814645 GGGTGGGAAGATATGACCCAGGG - Intergenic
1165329873 19:35135430-35135452 GGGTGGGAGGAGAGGCCCTGGGG + Intronic
1166295638 19:41888011-41888033 GGGTGGGAGGAGGCGGCCCAGGG - Intronic
1166781293 19:45344982-45345004 GGGTGGGAGGAGAGGGCCGAGGG - Intronic
1166856348 19:45784274-45784296 GGTTGGGAGGAGATGCCCTGGGG + Exonic
925815932 2:7748902-7748924 TGGTGGGAACAGATGTCATAGGG - Intergenic
926674110 2:15605213-15605235 GGGTGGGGTGAGATTGCCTAGGG + Intronic
927707389 2:25304887-25304909 GGATGGGAGGAGGGGGCCTAGGG - Intronic
927719272 2:25372633-25372655 GAGTGGGAAGAGCTGGGCTCTGG + Intergenic
928080778 2:28310391-28310413 GCCTGGGGAGAGATGGCCTGAGG - Intronic
928614498 2:33023602-33023624 AGATGAGAAGAGATGGCCTTGGG + Intronic
930048477 2:47194686-47194708 GGGTTGGGAGAGTGGGCCTATGG - Intergenic
931456106 2:62410963-62410985 GGCAGGGAAGAGATGGACAAGGG + Intergenic
932422319 2:71608449-71608471 CGGTGGACAGAGATGGCCTTGGG + Intronic
932871358 2:75402259-75402281 GGGGAGGAAGAGATAGCCAAAGG - Intergenic
933171582 2:79131446-79131468 CCCTGGGAAGAGATGACCTAAGG + Intergenic
934562586 2:95320866-95320888 GGCGGGGAGGAGAGGGCCTAGGG - Intronic
934562617 2:95320933-95320955 GGTGGGGAGGAGAGGGCCTAGGG - Intronic
937098786 2:119252796-119252818 GGGAGGGATGAGGTGGGCTAGGG - Intronic
937636023 2:124156231-124156253 GGGAGAGTAGAGATGACCTAGGG + Intronic
938373758 2:130790721-130790743 GGGAGGGAAGAGAGCTCCTAAGG + Intergenic
938630934 2:133166559-133166581 AGGTAGGAAAAGCTGGCCTAAGG - Intronic
939171303 2:138699539-138699561 GGGATGGTAGAGATGGCCTAGGG + Intronic
939622801 2:144440902-144440924 GGGTTGGATGACATGGCATATGG + Intronic
939879706 2:147616176-147616198 GGGTGGGAAGATAGGGTTTAAGG + Intergenic
940568117 2:155395033-155395055 GGGTGGTAATAGAGGACCTAGGG - Intergenic
940756892 2:157693666-157693688 GGATGGGAAAAGAGGGCCTAAGG - Intergenic
940961902 2:159795754-159795776 GGGTGGTAAGAGATGACATCAGG + Intronic
941514556 2:166456572-166456594 AGGTGGAAAGAGATTTCCTAAGG - Intronic
943631930 2:190263539-190263561 GGGCTGGAAGAGATCTCCTAGGG - Intronic
946272706 2:218607757-218607779 GGGTGGGGAGAGAAGGATTAAGG - Exonic
946327557 2:218992627-218992649 GGGTGGGAAAAGCTGGGCTCTGG + Intronic
946386323 2:219386620-219386642 GGGTGGGAGGAGATGTCAGAGGG - Intronic
947361392 2:229348960-229348982 TGGTGGGAAGAGGAGGCCAAAGG + Intergenic
947367310 2:229410010-229410032 GGGCAGGAAGAGGGGGCCTAGGG - Intronic
947389426 2:229623785-229623807 GGATGGGAAGCAATGCCCTAAGG - Intronic
949087205 2:242165281-242165303 TGGTGGGCAGAGTTGGCCCAGGG - Intergenic
1169000700 20:2165906-2165928 GGGTAGGAAGAGATTTCCAAAGG - Intronic
1169915027 20:10674910-10674932 GGGTGGCAAGAGATGGGCCTGGG + Intergenic
1172342695 20:34170974-34170996 TGGTGTGAACAGATGGACTAAGG - Intergenic
1172627268 20:36354519-36354541 GAGTGGCAAGAGAAGACCTATGG - Intronic
1172876292 20:38166311-38166333 GGGAGGGAAGAGAAGGCCGAGGG - Intronic
1175227359 20:57452391-57452413 GGGTGGTCAGAGAAGGCCTCTGG + Intergenic
1175737437 20:61396818-61396840 GGGTGGGGAGGGATGCCCCAGGG + Intronic
1175892014 20:62319844-62319866 GGGTGGCAAGGGAGGGCCTGGGG + Intronic
1177782733 21:25638426-25638448 GGGTGGGAGGAGAGGACCCAGGG - Intergenic
1178439136 21:32584308-32584330 GGTTGGGAAGGGAAGGGCTATGG + Intronic
1178523313 21:33303939-33303961 GGGAGGGAAGAGAGGGGCTTGGG + Intergenic
1179192766 21:39137316-39137338 GTGTGGGAGGTGATGGCCTTAGG - Intergenic
1179339589 21:40491873-40491895 GGGTTGGGAGTGATGGCATAGGG - Intronic
1179397630 21:41056161-41056183 GGGTGGGAAGAGGAGGACTGAGG - Intergenic
1184968405 22:47997774-47997796 GGGTGGGAAGTGCTGTCCCAGGG + Intergenic
1185169208 22:49282696-49282718 GGGTGGGGAGTGATGGACCATGG - Intergenic
950356040 3:12410067-12410089 GGCTGGGAAAAGATGGGATATGG + Intronic
951837173 3:26996294-26996316 GAATGGGAAGAGATGGTGTAAGG - Intergenic
952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG + Intergenic
952471201 3:33653707-33653729 GGCTGGGAAAAGATGGGGTAGGG + Intronic
954361710 3:50125752-50125774 GTGGGGGAAGGGATGGCCTGAGG - Intergenic
958770688 3:98422019-98422041 GGGTGGGAAGGGAAGGACCATGG - Intergenic
959099525 3:101994412-101994434 GGGTGGGAAAAGATTTTCTAAGG + Intergenic
959611518 3:108300278-108300300 GGGTGGGAAGAAACAGCCCAGGG + Intronic
962245447 3:133787025-133787047 GGGAGGGAAGAAATTGCCAAAGG + Intronic
962270001 3:133970629-133970651 GGGTGGGATGAGAAGGACTTTGG - Intronic
962278625 3:134033761-134033783 GGGAGGCAAGAGAAGGCCTGAGG + Intronic
962423013 3:135244531-135244553 GTATGGAAAGATATGGCCTAAGG - Intronic
964739747 3:159952926-159952948 GGGTGGAAAGTGATGGACAAGGG + Intergenic
969058722 4:4418154-4418176 GGCTGGGAAGAGACGGCCCTGGG + Exonic
969148041 4:5141504-5141526 GAGTGGGAAGAGAAGGCTTGGGG + Intronic
977223777 4:94370507-94370529 GTGTGGGAAGAGATGGCTGAGGG - Intergenic
982573706 4:157081574-157081596 AGGTAGAAAGAGATGGTCTAAGG - Intronic
984410369 4:179390467-179390489 TAGTGCTAAGAGATGGCCTAAGG + Intergenic
985214895 4:187640838-187640860 GTGTGGGAAGTCATGGCCAAGGG - Intergenic
986078771 5:4366974-4366996 GGGTGGTCAGAGGTGGCCTAGGG - Intergenic
986375088 5:7122774-7122796 GGGTGGGAGGAGATGTCTGAGGG - Intergenic
986600689 5:9469609-9469631 GGGATGGAACAGATGCCCTAGGG - Intronic
988372297 5:30387149-30387171 TGGTGGGGAGAGATGGATTATGG + Intergenic
989111965 5:37915061-37915083 GGGTTAGAACAGATGGCCTCTGG - Intergenic
989239663 5:39189449-39189471 CAGTGGGAAGAGATGGCCAGGGG - Intronic
989309847 5:40002281-40002303 GGGTGGGAACAGGTGGCATTTGG + Intergenic
989799723 5:45522988-45523010 GAGTGGGGAGGGATGGCCTTAGG - Intronic
990761355 5:59133610-59133632 GGGTGGGCAGAGCTGACCTGGGG - Intronic
996796660 5:127355113-127355135 GGGTGAGAAGAGTTAGCCTTCGG + Intronic
997358002 5:133276594-133276616 GAGTGGGGAGGGATGGCCTTTGG - Intronic
998041620 5:138954151-138954173 GGGTGGGAAGAGCCTGCCTGAGG - Intronic
998151987 5:139762862-139762884 GAGTGGGGAGAGATGGCCTGGGG + Intergenic
999423326 5:151464198-151464220 CTGTGGGAAGAGCTGGGCTAAGG - Intronic
1002663512 5:180806637-180806659 GAGTGGGAAGGGTTTGCCTAAGG - Intronic
1003264883 6:4556762-4556784 GGTTGGGAAGAGATGTGCTGTGG - Intergenic
1004465730 6:15883106-15883128 GAGTGGGAAGAGATGGCCTTGGG + Intergenic
1006110638 6:31742793-31742815 GGGTAGGAAGAGGAGGGCTATGG + Intronic
1006155193 6:32009909-32009931 GGGTGGGCAGCCAGGGCCTAAGG - Intergenic
1006161499 6:32042643-32042665 GGGTGGGCAGCCAGGGCCTAAGG - Intronic
1007107793 6:39295480-39295502 GGATGGGATGAGAAGGCCTTGGG + Intergenic
1007108027 6:39296716-39296738 GGGTGGGGAGAGGTGGCCCGGGG + Intergenic
1007762551 6:44141552-44141574 GGGTGGGTAGAGCAGACCTATGG + Intronic
1009642433 6:66355391-66355413 GGGTGGGAAGGGATAGCATTTGG + Intergenic
1010792677 6:80082861-80082883 GTGTGAGAAAAGATGGCCCAAGG - Intergenic
1011032523 6:82939234-82939256 TGGTGGGGAGAGAAGGCCTAGGG - Intronic
1011599260 6:89044810-89044832 GGGTGGGCGGAGAAGGCCTGAGG - Intergenic
1012882879 6:104812870-104812892 GGATGGGAAGAAAGGTCCTAGGG - Intronic
1015650519 6:135452823-135452845 GGTGGGGAAGAAATGGTCTATGG - Intronic
1018323409 6:162637250-162637272 GGGTGGGAGGAGGTGGCAGACGG - Intronic
1018790593 6:167144643-167144665 GGCAGGGAAGACATGACCTAGGG - Intergenic
1019048134 6:169163482-169163504 GGGTGGGAACTGCTGGCCGAGGG + Intergenic
1020649273 7:10855120-10855142 GGGTGGGGAGGGGTGGCTTATGG - Intergenic
1020788297 7:12594865-12594887 GGGAGTGAAGAGATGGTCAAGGG + Intronic
1021791050 7:24205870-24205892 GGATGGGAGGAGATCACCTAAGG + Intergenic
1022841249 7:34165911-34165933 GGATGGGAAAATATGGTCTATGG + Intergenic
1024533130 7:50409572-50409594 GGGTGGGCAGAGATGGGCTCTGG + Intergenic
1024590688 7:50880055-50880077 GAGTGGGGAGTGATGGGCTATGG + Intergenic
1025614262 7:63104749-63104771 GAGTTGGAAGAGGTGGCCCAGGG - Intergenic
1026374664 7:69738486-69738508 GAGAGGGAACAGATGGCCTCAGG - Intronic
1026636852 7:72090940-72090962 GGGTAAGAAGAGATGGCTAATGG + Intronic
1027225932 7:76243706-76243728 GGGTGGGAAGAGATGGCCTAAGG - Intronic
1029540445 7:101179565-101179587 GGGGCGGGAGAGAAGGCCTAGGG + Intronic
1030671121 7:112338208-112338230 GGGTGGGTAGAGAGGAGCTAGGG + Intronic
1030886966 7:114950423-114950445 GGGTGTGAAGTGATGAGCTACGG + Intronic
1032381263 7:131484336-131484358 GGGAGGGAAGAGATGGAATGTGG - Intronic
1032546536 7:132748490-132748512 GAGTGGGAAGGAATGGCCAATGG - Intergenic
1033139355 7:138811359-138811381 GAGGGGGAAGAGATGGCATTAGG - Intronic
1033466626 7:141596948-141596970 CTGTGGACAGAGATGGCCTAAGG - Intronic
1033878373 7:145850980-145851002 GGGTGGGGAGAGATGGTTTGGGG - Intergenic
1034978077 7:155459366-155459388 GGCTGGGAAGAGATGCGCCAAGG - Intronic
1035083697 7:156238321-156238343 GAAGGGGAAGAGATGGCCCAGGG - Intergenic
1035497521 8:66059-66081 TGGTGGGCAGAGTTGGCCCAGGG + Intergenic
1036811871 8:11872647-11872669 TGGTGGGAAGTGGTGGCCTCTGG - Intergenic
1037689899 8:21172803-21172825 GGGCAGGAAGAGAAGGCCAAGGG + Intergenic
1038670803 8:29581314-29581336 GTGTGGGAAGGGATGGCTTGTGG - Intergenic
1039382923 8:37102780-37102802 GGCTGGGGAGGGATGGCCCAGGG - Intergenic
1040302503 8:46195332-46195354 GGGTTGGGAGAGATGTCCTTGGG - Intergenic
1040558548 8:48503019-48503041 GGGAGGGCAGAGATGGGCTGTGG + Intergenic
1041813157 8:61935021-61935043 GTGTGGGAAGATATGGGCTGTGG - Intergenic
1041947493 8:63462503-63462525 GGGTTCCAAGAGATGGCCGAAGG + Intergenic
1042137901 8:65649773-65649795 GGGTGGGGGGAGATGGAGTAGGG - Intronic
1045906458 8:107351678-107351700 AGGTGGGATGAGAAGCCCTAGGG + Intronic
1047981012 8:130182147-130182169 GGGTGGGAAGAGAAGAAATATGG + Intronic
1048148050 8:131864859-131864881 GGGTGGGAAGGGAAGCCATATGG - Intergenic
1050614545 9:7388332-7388354 TGGTGTGAAAAGAGGGCCTAGGG + Intergenic
1051528903 9:18078002-18078024 GGGTGGGAAGGGATGGAGGAAGG + Intergenic
1051705657 9:19877288-19877310 GGCTGGGAAGAGAGAGACTATGG + Intergenic
1052298344 9:26924482-26924504 GGGTTGGAGGAGATGGACGAAGG - Intronic
1054905419 9:70410675-70410697 AGGTGGGCAGAGATGGCATTTGG - Intronic
1057144414 9:92748642-92748664 GGATGGGAAGAGCTGGCTGAGGG - Intronic
1057272440 9:93658579-93658601 GGTGGGGGACAGATGGCCTATGG + Intronic
1060193938 9:121610828-121610850 GGGTGGAAAGAGATGGGCCCAGG - Intronic
1060758555 9:126229780-126229802 GGGTGGGAAGAGCTGTGCAAAGG + Intergenic
1061201678 9:129141790-129141812 GGCAGGGAAGAGAGGGCCGATGG - Intronic
1061422445 9:130479690-130479712 GGGTGGGAAGAGAGGGCAGTGGG - Intronic
1062402665 9:136379283-136379305 GTTTGGGAAGAGGTGGCCTGTGG + Exonic
1186059851 X:5692572-5692594 GGGTAGGAAGATTTGGACTAGGG - Intergenic
1186613175 X:11158749-11158771 GGGAGGGAAGAGAAGACCTGAGG - Intronic
1186808756 X:13166505-13166527 GGGATGGAAGATATGACCTAAGG + Intergenic
1189510007 X:41652964-41652986 GGGTGGGAAGGGGAGGCCTTGGG + Intronic
1189823146 X:44890067-44890089 GGGTGGGAAGAGATGAAGGAAGG - Intronic
1189911025 X:45810658-45810680 GGGAGGGAAGAGATGGTGTGTGG - Intergenic
1190022499 X:46891912-46891934 GGCTGGAAAGAGATGGCTTTTGG + Intronic
1190287973 X:48973067-48973089 GGGTGGGAAGAGATGGGCAGAGG - Intergenic
1191110180 X:56798370-56798392 GGGTGGGAGGATGTGGCTTAGGG - Intergenic
1191895150 X:65984762-65984784 GGGTGGGGAGAGACGGCATCAGG + Intergenic
1192178172 X:68898853-68898875 GGGTGGGGTGAGCTGGCCTCTGG - Intergenic
1195702244 X:107714380-107714402 TGGTGCCAAGAGATGTCCTAAGG - Exonic
1197925766 X:131645497-131645519 GAGAGGGAAGAGAGGGCATATGG + Intergenic
1198438001 X:136636145-136636167 GGATGGGAAGAGAAAGCTTAAGG - Intergenic
1199534876 X:148891142-148891164 GGGTAGGCAGAGATGGCCACTGG + Intronic
1200398649 X:156006077-156006099 GGGTGGGATCAGAGGGCCTGTGG - Exonic