ID: 1027228816

View in Genome Browser
Species Human (GRCh38)
Location 7:76260716-76260738
Sequence CACTAGTGCGAGTGGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027228805_1027228816 3 Left 1027228805 7:76260690-76260712 CCTCCCAGGGGTCCCGTGCCCAC 0: 1
1: 0
2: 2
3: 16
4: 252
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228807_1027228816 -1 Left 1027228807 7:76260694-76260716 CCAGGGGTCCCGTGCCCACCAAC 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228796_1027228816 18 Left 1027228796 7:76260675-76260697 CCAGTCCCCCTCTGCCCTCCCAG 0: 1
1: 1
2: 10
3: 100
4: 1028
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228809_1027228816 -10 Left 1027228809 7:76260703-76260725 CCGTGCCCACCAACACTAGTGCG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228801_1027228816 12 Left 1027228801 7:76260681-76260703 CCCCTCTGCCCTCCCAGGGGTCC 0: 1
1: 1
2: 10
3: 70
4: 654
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228806_1027228816 0 Left 1027228806 7:76260693-76260715 CCCAGGGGTCCCGTGCCCACCAA 0: 1
1: 0
2: 1
3: 8
4: 106
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228808_1027228816 -9 Left 1027228808 7:76260702-76260724 CCCGTGCCCACCAACACTAGTGC 0: 1
1: 0
2: 0
3: 23
4: 203
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228802_1027228816 11 Left 1027228802 7:76260682-76260704 CCCTCTGCCCTCCCAGGGGTCCC 0: 1
1: 0
2: 6
3: 73
4: 672
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228803_1027228816 10 Left 1027228803 7:76260683-76260705 CCTCTGCCCTCCCAGGGGTCCCG 0: 1
1: 0
2: 1
3: 51
4: 515
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228794_1027228816 25 Left 1027228794 7:76260668-76260690 CCTGCTCCCAGTCCCCCTCTGCC 0: 1
1: 0
2: 5
3: 79
4: 1171
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228804_1027228816 4 Left 1027228804 7:76260689-76260711 CCCTCCCAGGGGTCCCGTGCCCA 0: 1
1: 0
2: 0
3: 19
4: 254
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228800_1027228816 13 Left 1027228800 7:76260680-76260702 CCCCCTCTGCCCTCCCAGGGGTC 0: 1
1: 0
2: 9
3: 65
4: 647
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1027228795_1027228816 19 Left 1027228795 7:76260674-76260696 CCCAGTCCCCCTCTGCCCTCCCA 0: 1
1: 1
2: 6
3: 87
4: 748
Right 1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027228816 Original CRISPR CACTAGTGCGAGTGGCCCTG GGG Intronic
900509917 1:3053882-3053904 AGCGTGTGCGAGTGGCCCTGTGG + Intergenic
906117732 1:43367277-43367299 CACGTGTGTGAGTGGCCCCGCGG - Intronic
915309838 1:155001405-155001427 CACTAGTGGGAGGGGCCCTTTGG + Intergenic
916592340 1:166204588-166204610 GATTAGTGGGAGTGGCACTGGGG - Intergenic
1070084959 10:73228212-73228234 CTCTGGTGAGAGTAGCCCTGGGG - Intronic
1071055612 10:81505505-81505527 CAGAAGTGAGGGTGGCCCTGGGG - Intergenic
1072138972 10:92573624-92573646 CACTAGTGCGGGGGGCGCAGGGG - Intronic
1080335105 11:31186530-31186552 AACTAGTATGAGTGGCACTGAGG - Intronic
1082192532 11:49264669-49264691 CACTAGATCTAGTGTCCCTGGGG - Intergenic
1085488150 11:76886210-76886232 CAGTACTGCAAATGGCCCTGTGG + Intronic
1086673585 11:89576302-89576324 CACTAGATCCAGTGTCCCTGGGG + Intergenic
1088683500 11:112265463-112265485 CACTAGTCTGAGGAGCCCTGGGG + Intronic
1089531567 11:119133182-119133204 CACCAGTTCAAGTGGCCCTCAGG + Exonic
1090321194 11:125844986-125845008 CCCTAGTGGGAGGGGCACTGTGG + Intergenic
1095916790 12:47487784-47487806 CAGAAGTGAGGGTGGCCCTGGGG + Intergenic
1096280117 12:50245517-50245539 CATTGGTGCCAATGGCCCTGGGG + Intronic
1098911326 12:76211985-76212007 CTCTGGGGCCAGTGGCCCTGAGG + Intergenic
1102969619 12:117155753-117155775 CGCTTGTGCCAGTGGCCCCGCGG - Intronic
1103480619 12:121247850-121247872 CACTAGTCCCAGTGGGCCGGCGG - Intronic
1103886576 12:124206971-124206993 CACTAGTGGAACTGGCCTTGTGG - Intronic
1106612761 13:31299489-31299511 GACTGGTGCTAGTGGCCCTATGG - Intronic
1118302248 14:64626083-64626105 CACCTGAGCCAGTGGCCCTGGGG + Intergenic
1119286818 14:73461924-73461946 CCCTAGTGAGATTGCCCCTGTGG - Intronic
1121519428 14:94576005-94576027 CACTTGAGCGGGTGGCTCTGAGG - Intronic
1122552524 14:102557584-102557606 CCCTAGTGAGAGTGGGGCTGGGG - Intergenic
1132753416 16:1469971-1469993 CCCTCTTGCGAGTGGACCTGCGG - Intronic
1132869798 16:2110876-2110898 CACCCGTGCCAGGGGCCCTGAGG - Exonic
1133763859 16:8821672-8821694 CCCTAGGGCGAGTGACCCTTGGG - Intronic
1135722337 16:24828333-24828355 CACCAGTGCAAATGGCACTGTGG - Intergenic
1137506255 16:49056412-49056434 CCCTGGTGCGAGTTGCTCTGTGG - Intergenic
1141597467 16:85106235-85106257 CACTAGTGTCCGGGGCCCTGTGG + Intronic
1144850434 17:18241382-18241404 CACGAGGGTGAGGGGCCCTGGGG + Intronic
1145005930 17:19337810-19337832 CACTGGTGTGAGTGGCAGTGAGG - Intronic
1151227030 17:72655290-72655312 CACTGGTGGGGGTGGCCCAGTGG + Intronic
1152798946 17:82322236-82322258 CACCAGTGCCAGCGGCCTTGGGG + Exonic
1153705168 18:7737620-7737642 GCCTAGTGCTAGTGGTCCTGGGG + Intronic
1153925523 18:9832046-9832068 GACTAGTGCCAGTGACTCTGTGG + Intronic
1157880681 18:51318470-51318492 CACTAGAGCCAGAGTCCCTGGGG - Intergenic
1158103228 18:53854675-53854697 CTCTAGTGGGAGTGACTCTGAGG - Intergenic
1162704544 19:12545565-12545587 CAGAAGTGTGGGTGGCCCTGCGG - Intronic
1164669765 19:30065767-30065789 CATGAGTGAGACTGGCCCTGAGG + Intergenic
1165353535 19:35290585-35290607 GACTATTGCGAGTGCTCCTGTGG + Intergenic
1168452551 19:56477498-56477520 CGCTTGTGCGTGTGGCGCTGAGG - Intronic
935903381 2:107816600-107816622 AACTAGTGCGATTGGCCTTATGG - Intergenic
936010646 2:108923228-108923250 CACTAGTGAAAGTGCTCCTGTGG - Intronic
945952823 2:216055722-216055744 CACTAGAGCCTGTGGCCCTGGGG - Intronic
1182904636 22:33924608-33924630 CTCTAATGCTAGTGCCCCTGTGG - Intergenic
1183830300 22:40415300-40415322 CACCAGTGCAGGTGGCACTGAGG - Intronic
1184424582 22:44402072-44402094 CACCCGTGACAGTGGCCCTGTGG - Intergenic
1184519357 22:44983448-44983470 CACTAGTGGCAAAGGCCCTGAGG + Intronic
952411416 3:33053193-33053215 CACTTATGAGAGTTGCCCTGAGG + Intronic
954856996 3:53652657-53652679 CACTACTACCAGTGGCCCTGTGG - Intronic
960275206 3:115721193-115721215 ATCTGGTGCGTGTGGCCCTGTGG + Exonic
966200867 3:177358896-177358918 CACTGGGGCCAGAGGCCCTGTGG - Intergenic
967930407 3:194686691-194686713 AACTACTGGGAGCGGCCCTGTGG - Exonic
970750318 4:19352330-19352352 CACTTGTGGGAGGGACCCTGTGG - Intergenic
971571243 4:28213596-28213618 CATTTGTGCAAGTGGTCCTGAGG - Intergenic
985651606 5:1110254-1110276 CACTTTTGAGGGTGGCCCTGTGG - Intronic
990724735 5:58740954-58740976 CAGAAGTGAGGGTGGCCCTGAGG - Intronic
991607674 5:68419925-68419947 CAGTAGTGCTAGAGGCCGTGGGG + Intergenic
996307097 5:122059823-122059845 CATTAGTGCGAGTCTCCCTCTGG - Intronic
997380189 5:133430292-133430314 CTCCAGTTTGAGTGGCCCTGTGG + Intronic
999042316 5:148427793-148427815 GACTAATGGGAGTGGCTCTGGGG + Intronic
1001757127 5:174179182-174179204 CACTGGTGGGAGTGGCTCTGCGG + Intronic
1003725540 6:8758628-8758650 CCCTAGTGCGAGAGATCCTGTGG - Intergenic
1012015536 6:93845033-93845055 CACTAGTGTCATTGGCCCTAAGG + Intergenic
1019751587 7:2734140-2734162 CCATAGTGCGAAGGGCCCTGCGG + Intronic
1023867829 7:44247212-44247234 GGTTAGTGCGAGTGGCCCTGGGG + Intronic
1024987618 7:55209008-55209030 GCCTAGTGAGAGTGGCACTGGGG - Exonic
1027228816 7:76260716-76260738 CACTAGTGCGAGTGGCCCTGGGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1029690190 7:102176059-102176081 CAGCTGTGCGCGTGGCCCTGGGG - Intronic
1032514960 7:132499929-132499951 CCCTAGTGTGTGTGGCCCTATGG - Intronic
1034945908 7:155261698-155261720 CATGGGTGCGAGTGCCCCTGTGG - Intergenic
1035261681 7:157665538-157665560 CCCTGGTGGGAGTGGCCCCGTGG - Intronic
1036416419 8:8553789-8553811 CATTTCTGCCAGTGGCCCTGGGG + Intergenic
1043738977 8:83784306-83784328 CTCTTGTGGGAGGGGCCCTGTGG + Intergenic
1044697411 8:94936987-94937009 GACTAGTGCTGGTAGCCCTGGGG + Intronic
1048635470 8:136290764-136290786 CAGTAGTGGGAGGGGACCTGGGG + Intergenic
1050402240 9:5268482-5268504 CACAATTGTGAGTGGCCTTGAGG + Intergenic
1061676329 9:132217990-132218012 CACCAGTGACACTGGCCCTGAGG - Intronic
1187487544 X:19718958-19718980 CACTAGGTGGAGGGGCCCTGTGG + Intronic
1196182085 X:112703628-112703650 AACTGGTGCTAGTGGCCATGAGG - Intergenic
1202332424 Y:23768860-23768882 CACTTGTCCCAGAGGCCCTGAGG + Intergenic
1202349471 Y:23972432-23972454 CACTTGTCCCAGAGGCCCTGAGG + Intergenic
1202521304 Y:25697672-25697694 CACTTGTCCCAGAGGCCCTGAGG - Intergenic
1202538345 Y:25901203-25901225 CACTTGTCCCAGAGGCCCTGAGG - Intergenic