ID: 1027229600

View in Genome Browser
Species Human (GRCh38)
Location 7:76264555-76264577
Sequence CAGGACTTCCAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 642
Summary {0: 1, 1: 0, 2: 9, 3: 74, 4: 558}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027229585_1027229600 24 Left 1027229585 7:76264508-76264530 CCTCCCAGACTGGGCAGCATTTG 0: 1
1: 0
2: 2
3: 17
4: 211
Right 1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG 0: 1
1: 0
2: 9
3: 74
4: 558
1027229584_1027229600 25 Left 1027229584 7:76264507-76264529 CCCTCCCAGACTGGGCAGCATTT 0: 1
1: 1
2: 1
3: 25
4: 230
Right 1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG 0: 1
1: 0
2: 9
3: 74
4: 558
1027229587_1027229600 20 Left 1027229587 7:76264512-76264534 CCAGACTGGGCAGCATTTGCGAC 0: 1
1: 0
2: 0
3: 6
4: 171
Right 1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG 0: 1
1: 0
2: 9
3: 74
4: 558
1027229586_1027229600 21 Left 1027229586 7:76264511-76264533 CCCAGACTGGGCAGCATTTGCGA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG 0: 1
1: 0
2: 9
3: 74
4: 558
1027229593_1027229600 -2 Left 1027229593 7:76264534-76264556 CCCAGGGAGGTGTTCACGGGCCA 0: 1
1: 0
2: 2
3: 5
4: 93
Right 1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG 0: 1
1: 0
2: 9
3: 74
4: 558
1027229594_1027229600 -3 Left 1027229594 7:76264535-76264557 CCAGGGAGGTGTTCACGGGCCAG 0: 1
1: 0
2: 3
3: 17
4: 129
Right 1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG 0: 1
1: 0
2: 9
3: 74
4: 558

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027229600 Original CRISPR CAGGACTTCCAGGAGGAGGA AGG Intronic
900002674 1:23424-23446 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
900022392 1:193949-193971 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
900152221 1:1183669-1183691 GAGGGCTGCCTGGAGGAGGAGGG - Intronic
900379415 1:2376440-2376462 CCGGGCTTTCAGGAGGAGGGAGG + Intronic
900418518 1:2545858-2545880 CAGGAAGTGCAGGAGGAGGGTGG + Intergenic
900528707 1:3142159-3142181 CTGGTCTTCCAGGAAGAGGTTGG + Intronic
900618113 1:3574428-3574450 AAGGGCTTCCTGGAGGAGGTGGG - Intronic
900997772 1:6131702-6131724 GAGGACTTCCTGGAGTACGAAGG - Exonic
901631709 1:10651294-10651316 CAGGGCCTCCTGGAGGAGAAGGG + Intronic
901876517 1:12169869-12169891 CAAGACTTCCAGGGGTAGGTGGG - Intronic
901972341 1:12918033-12918055 CAGCTGTTTCAGGAGGAGGAGGG + Intronic
902012838 1:13283729-13283751 CAGCTGTTTCAGGAGGAGGAGGG - Intronic
902086899 1:13869640-13869662 CAGCTCTTCCAGGAGGTGGGAGG - Intergenic
902697575 1:18150647-18150669 CTGGAATTCAAGGAGGAGAAAGG - Intronic
903006643 1:20303156-20303178 CAGGACTTCCTAGAGGGGGCTGG + Intronic
903034895 1:20486780-20486802 CAGGGCCTCCAGGAGGGGGAGGG + Intergenic
903101350 1:21033565-21033587 CAGGACTTCCACGTGGAATAAGG + Intronic
903294521 1:22335345-22335367 GAGGACTTCCTGGAGGAAGGGGG + Intergenic
903517756 1:23923753-23923775 GAAGACTTCCTGGAGGAAGAAGG - Intergenic
904198758 1:28805481-28805503 TAGGTCTGCCAGGAGGAGGAGGG - Intergenic
904256095 1:29255847-29255869 TGGGACTTCCAGGAGGAAGAGGG - Intronic
904272906 1:29362186-29362208 CAGGGCCTCCGGGAGGAGGCTGG + Intergenic
904299023 1:29542209-29542231 CAGGACTTTAAGAAGAAGGATGG - Intergenic
904476526 1:30768671-30768693 GAAGGCTTCCAGGAGGAGGCGGG + Intergenic
904499252 1:30904776-30904798 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
904732689 1:32606831-32606853 CAGGACTACCAGCTGCAGGAAGG - Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904945782 1:34197786-34197808 CAGGACGTGCAGGAGGAGGTCGG - Exonic
905032123 1:34892389-34892411 TGGGAGTTCCAGAAGGAGGAGGG + Intronic
905194454 1:36264337-36264359 CAGGACTGCCAGGAGAATTAAGG - Intronic
905374377 1:37509141-37509163 CAAAACTTCCAGGAAGAAGAGGG + Intronic
905858641 1:41331323-41331345 GAGGGCTTCCAGGAGGAAGTGGG + Intergenic
906156211 1:43615469-43615491 GAAGGCTTCCTGGAGGAGGAGGG - Intronic
906351048 1:45059896-45059918 CAGGACTACCAGGTTGAGGTGGG + Intronic
906684237 1:47752712-47752734 CAGGACTTTCAAGAGGGGGGTGG - Intergenic
907020221 1:51059749-51059771 CAGGACTACCAGCTGCAGGAAGG + Intergenic
907974107 1:59414374-59414396 CAGGACTTCAAGGAAGGGGATGG + Intronic
907985358 1:59524591-59524613 CAGGACTACCAGCTGCAGGAAGG + Intronic
908156502 1:61358835-61358857 CAACACTTCCAGGTGGAGGCAGG + Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561873 1:77016301-77016323 GAAGAGTTTCAGGAGGAGGAGGG - Intronic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911048417 1:93648811-93648833 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
911100370 1:94091022-94091044 CAGGAATTCCAGGTGGAGAAAGG + Intronic
912309168 1:108602344-108602366 CAGCACTTCCAGAGGGAGCATGG - Intronic
912419014 1:109530942-109530964 CAGGACTGCAAGGAAGAGGCTGG + Intergenic
913531010 1:119734338-119734360 CAGGGCTTCCACAATGAGGAGGG - Intronic
914242517 1:145861285-145861307 CAGTAGTTGCAGGATGAGGAAGG + Intergenic
914321101 1:146561097-146561119 CAGAGCTTCTAGGTGGAGGATGG - Intergenic
914377040 1:147080654-147080676 CAGGCCCTCCAGGAGGAGCGAGG - Intergenic
914474695 1:148013644-148013666 CAGGCCCTCCAGGAGGAGCGAGG + Intergenic
914492328 1:148160243-148160265 CAGGCCTTCCAGGAGGAGCGAGG + Intergenic
915673865 1:157513128-157513150 CTGGACTTCCATGAGAGGGAAGG - Intergenic
915720138 1:157978807-157978829 GTGGACTTCCCGGAGCAGGAGGG - Intergenic
915896268 1:159813557-159813579 AAGGACTTCCAGCAGGATGGTGG + Intronic
917595428 1:176524563-176524585 AAAGACTTCCTGAAGGAGGAAGG + Intronic
918120451 1:181534070-181534092 CAGGACTTCCAGGAAAATGTTGG + Intronic
919264033 1:195237993-195238015 CAGGACTACCAGCTGCAGGAAGG + Intergenic
920107397 1:203563632-203563654 CTGGTCTTCCAGGAGGAGAAGGG - Intergenic
920310850 1:205047385-205047407 CAGACCTTCCTGGAGGATGATGG + Intronic
920686889 1:208116170-208116192 GAAGACTTCCTGGAGGAGGGAGG - Intronic
920821307 1:209383975-209383997 CAGAAATTACAGGAGGAGGCTGG - Intergenic
920848194 1:209610954-209610976 GAAGGCTTCCAGGAGGAGGTGGG + Intronic
920932950 1:210406077-210406099 CAGGCCCTCCAGGAGGAGGGTGG + Intronic
920970803 1:210742331-210742353 CAGGACTTCCAGCTGAATGAAGG - Intronic
921039619 1:211416946-211416968 CAGGACTCCCAGGAGGGCGGCGG - Intergenic
921674662 1:217964872-217964894 CAGGACTACCAGCTGCAGGAAGG - Intergenic
922562915 1:226582080-226582102 CAGGGCTTCCAGGAGGAGGCTGG - Intronic
923087016 1:230709804-230709826 CAGCAGGTCCAGGAGGTGGACGG + Intronic
923596944 1:235367675-235367697 AAGGCCTTCCAGGAGGCGCAGGG - Intronic
923654227 1:235901463-235901485 CTTGACTCCCAGGAGAAGGAGGG - Intergenic
924256893 1:242191758-242191780 CAGGACTTCAAGAAAGAAGAGGG + Intronic
924290685 1:242533749-242533771 CAGACCTCCCAGGGGGAGGAAGG - Intergenic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1063185576 10:3647816-3647838 CAGGACTTGCAGCAGGGGCAGGG - Intergenic
1063295487 10:4800897-4800919 CAGGCTGTGCAGGAGGAGGATGG - Intronic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1065625570 10:27625563-27625585 TAGGCCTTCAAGGCGGAGGAAGG + Intergenic
1066337050 10:34488654-34488676 CTGGGCTTCCAGGCGGACGACGG - Intronic
1066517323 10:36177465-36177487 CAGGAATTATATGAGGAGGAGGG - Intergenic
1067223670 10:44361819-44361841 CAGGCTTTCCTGGAGGAGAAGGG + Intergenic
1067343739 10:45423453-45423475 CAGGGCTTCCTGGAGGAGGCAGG - Intronic
1067731363 10:48814042-48814064 CAGCATTTCCAGGAGGAGCAAGG - Exonic
1067803217 10:49374453-49374475 CAAGCCTGCCAGGGGGAGGAAGG - Intronic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1069664031 10:70143185-70143207 TAGGAGTTCCAGGAGGAGATGGG - Intronic
1069815053 10:71188451-71188473 GAGGCCTTCCAGGAGGCAGAGGG - Intergenic
1069825668 10:71253685-71253707 CAGGGCTGCCAAGGGGAGGAGGG + Intronic
1069865755 10:71501827-71501849 CCGGCCAGCCAGGAGGAGGAGGG + Intronic
1069945321 10:71981517-71981539 CTGGACTTTGAGGAGGAGAAAGG + Intronic
1070279409 10:75037849-75037871 CAGGACGGTGAGGAGGAGGATGG - Exonic
1070637233 10:78139376-78139398 CAGGACTGCCGGGAGGAAGCAGG - Intergenic
1070686693 10:78490092-78490114 CAGACCTTCCAGGAGAAGGAAGG + Intergenic
1070755241 10:78987966-78987988 CAGGACTGCTGGGAGGAGAATGG + Intergenic
1070866646 10:79711328-79711350 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1070880435 10:79849449-79849471 CAGGACCTGGAGCAGGAGGAAGG + Exonic
1071515038 10:86291557-86291579 GAGGGCTTCCTGGAGGTGGATGG - Intronic
1072008866 10:91286269-91286291 CAGGGTTTGCAGGAGGAGCAGGG - Intergenic
1072123130 10:92421175-92421197 CACAACTTCCAGGAGCAAGAGGG + Intergenic
1072759723 10:98046503-98046525 CAGGAATTCCAGGCTGAGGGTGG + Intergenic
1073185679 10:101613851-101613873 CAGAACTTCCCTGAGGAGGCTGG - Intronic
1073591520 10:104762160-104762182 GAGGACTTACTGGAGGAGGTGGG - Intronic
1074242500 10:111652928-111652950 CTTAACTTCCAGGTGGAGGAAGG + Intergenic
1074368047 10:112875956-112875978 CAGGGCTGCCAGGAGCAGGGAGG + Intergenic
1074676744 10:115859779-115859801 CAGGACTTCCATTAAGAGTAAGG - Intronic
1074813880 10:117130575-117130597 CAGGCCTTGGAGGAGGAGGCAGG - Intronic
1075032023 10:119030030-119030052 CAGGACGACGAGGAGGAGGAGGG - Exonic
1075555602 10:123429281-123429303 ATGAGCTTCCAGGAGGAGGACGG + Intergenic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1075995643 10:126874093-126874115 CTGGAGTTCCAGGAGGAGGTGGG - Intergenic
1076334878 10:129699758-129699780 GAGGTCTTCCTGGAGAAGGACGG - Intronic
1076498527 10:130915748-130915770 CAAGAGTTCCAAGAGAAGGAAGG + Intergenic
1076621839 10:131793991-131794013 CAGGGCTTCCAGAAGGCGAATGG - Intergenic
1076743989 10:132503717-132503739 CAGGACTCCCAGGTGGAGGAAGG + Intergenic
1077202668 11:1319379-1319401 GAAAACTTTCAGGAGGAGGAGGG + Intergenic
1077370042 11:2177530-2177552 GGGGACTGCCTGGAGGAGGAGGG - Intergenic
1077407813 11:2390560-2390582 GAGGGCTTCTAGGAGGAGGCAGG + Intronic
1077504449 11:2923643-2923665 GAGGGCTTCCTGGAGGAGGTTGG + Intronic
1078758766 11:14235068-14235090 CAGCACTGCCAGGTAGAGGAGGG - Intronic
1079384813 11:19969345-19969367 AAGGACTTCCAGGAAGATGTGGG - Intronic
1080457284 11:32428766-32428788 CAGGACTTTCGGCAGGAAGACGG + Intronic
1081840661 11:46199105-46199127 CAGGGTTTCCAGGAAGAGGTTGG - Intergenic
1082696802 11:56377140-56377162 CAAGACTTCCAGGAAGTAGAAGG - Intergenic
1082767337 11:57180215-57180237 CGGGGATTCCAGGAGGAGGGAGG + Intergenic
1082831839 11:57624118-57624140 CAGGACCACCAGGGTGAGGATGG + Intergenic
1083343162 11:61971979-61972001 CAGCACATCCTGGAGCAGGAGGG + Intergenic
1083637617 11:64128994-64129016 CAGGACTTCCTGGGGAAGGGTGG - Intronic
1083949793 11:65947608-65947630 CAGGACTCCCTGCAGAAGGAGGG + Exonic
1083954896 11:65977813-65977835 CAGGACTTCAAGGAGAAGGACGG + Exonic
1084009469 11:66339529-66339551 CAGGACTTCCAAGAGGAGGGTGG + Intronic
1084405665 11:68971424-68971446 GGGGACTTCCCGGAGGAGGCAGG - Intergenic
1085258920 11:75193254-75193276 CAGGACCACCAGCAGGAAGATGG - Exonic
1085322756 11:75584608-75584630 AAGGACTGGGAGGAGGAGGAAGG + Intergenic
1085745747 11:79112818-79112840 GAAGACTTCCTGGAGGAGGTGGG - Intronic
1085802480 11:79603235-79603257 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1088032509 11:105268466-105268488 CAGAATTTCCAGGATGGGGAGGG - Intergenic
1088074276 11:105827044-105827066 TAGGACTTTCTGGATGAGGAAGG - Intronic
1088817057 11:113428589-113428611 GAGAACTTCCTGGAGGAGGGAGG + Intronic
1089376756 11:118000059-118000081 CAGAGCTTCCAGCAGGAGGAAGG + Exonic
1089583524 11:119496047-119496069 CAGAGACTCCAGGAGGAGGAGGG - Intergenic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1090416746 11:126545682-126545704 CAGGCCTTCAGGGAGAAGGAAGG + Intronic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1091376091 12:25487-25509 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
1092077188 12:5683805-5683827 GAGGGCTTCCTGGAGGAGGCAGG + Intronic
1092118836 12:6029505-6029527 CAAGAAATCCAGGAGGATGAAGG + Intronic
1092899854 12:13048338-13048360 CAGGACTTCAAGGACAAAGAAGG - Intronic
1094524293 12:31221512-31221534 GAGGGCTTCCAGGAAGAGGTGGG + Intergenic
1096179932 12:49545048-49545070 AGGGACTTCAAGGAGGATGAGGG - Intronic
1096612194 12:52809513-52809535 CAGGAATGCCAGTAGGAGGACGG + Intronic
1096629526 12:52916958-52916980 CAGGACTGCCTGGAGGAATAGGG + Intronic
1098190663 12:67945167-67945189 GAAGGCTTCCTGGAGGAGGAGGG + Intergenic
1100055248 12:90501230-90501252 CAGCTTTTCCAGGAGGAGGAAGG + Intergenic
1100355999 12:93830204-93830226 CAGGCCCTCCAAGAAGAGGATGG + Intronic
1100478175 12:94953096-94953118 CAGGACATGCAGCAGGAGTATGG - Intronic
1100510136 12:95262937-95262959 CAGGACTTCCTGTTGCAGGATGG - Exonic
1101698971 12:107153793-107153815 TAGGACTTACAGGAAGTGGATGG - Intergenic
1102068053 12:109995761-109995783 CAGGACACCCAGGCGGAGAAAGG + Intronic
1102488393 12:113273588-113273610 CAGGGGTTCCGGGAGTAGGAGGG - Exonic
1103163365 12:118749629-118749651 CAGTTCTTCCAGGTGGAGGTTGG - Intergenic
1103196029 12:119044454-119044476 CAGGACTCCAGGGAGGAGAATGG + Intronic
1103609949 12:122117231-122117253 CAAGAGATCCACGAGGAGGATGG + Intronic
1104080447 12:125425606-125425628 CAGGAGTTCAGGGAGAAGGAGGG - Intronic
1104391297 12:128392602-128392624 GAAGACTTCCTGGAGGAGGTGGG + Intronic
1104657999 12:130588166-130588188 AAGGGCTTCCTGGAGGAGGCAGG - Intronic
1105059374 12:133134399-133134421 CTGGCCTTGCAGGTGGAGGAAGG + Intronic
1105442875 13:20429992-20430014 GAGGAGTTCGGGGAGGAGGAGGG - Intronic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1109058565 13:57582802-57582824 CAGTACCTCCAAGAGGGGGATGG + Intergenic
1110245739 13:73322068-73322090 CAGAACTTCCTTGATGAGGAAGG + Intergenic
1112504843 13:99969577-99969599 CAGGCCTTCCGGGAGGGGAAGGG - Intronic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113149123 13:107242346-107242368 CAGGACATTGAGGAGGAGAAGGG - Intronic
1115163355 14:30420363-30420385 CAGGACCTCCAGAAGTAGGCAGG + Intergenic
1115180653 14:30622194-30622216 GAGGTCTTCCTGGAGGAGGTGGG + Exonic
1116929508 14:50675858-50675880 CAGGCCTTCCAGGAGGATTGAGG + Intergenic
1117487926 14:56217285-56217307 CAGGCCTGCCAGGAGGTGGAGGG - Intronic
1117630238 14:57683792-57683814 CAGGACTTCCAGTAGGAAAGGGG + Intronic
1117829174 14:59733300-59733322 CAGGACTTCCAAGACCAGCATGG - Intronic
1118892368 14:69921052-69921074 CAGGACACCCAGGAGGACCATGG - Intronic
1119021992 14:71124015-71124037 CAGGATCACCAGGAGGAGGCGGG - Intergenic
1119978978 14:79058280-79058302 CAGGAAGTCCAGGAACAGGAAGG + Intronic
1120286100 14:82504005-82504027 CAGGAGTTCCAGGAGGTGAAAGG - Intergenic
1120673370 14:87389853-87389875 CTGGACTTCCAGAAAAAGGAAGG + Intergenic
1120780089 14:88479260-88479282 GAGGACTTCGAGGAGGAGAGCGG - Exonic
1121123207 14:91389306-91389328 CGGGAAGGCCAGGAGGAGGATGG - Intronic
1121866418 14:97366620-97366642 GAAGACTTCCTGGAGGAGGAGGG - Intergenic
1122319516 14:100845394-100845416 CAGGCCGGCGAGGAGGAGGAGGG - Intergenic
1122634103 14:103122321-103122343 CAGGTCTTCCAGGACCAGGGGGG - Intergenic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1123009019 14:105338373-105338395 AGGGACTTCCGGGAGAAGGAAGG - Intronic
1123062832 14:105601971-105601993 CAGCACTTGCAGGGGGAGGCTGG - Intergenic
1202884432 14_KI270722v1_random:90942-90964 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
1123681312 15:22766092-22766114 AGAGGCTTCCAGGAGGAGGAGGG + Intergenic
1124047253 15:26161710-26161732 CAGCAGTACCAGCAGGAGGAAGG - Intergenic
1124073651 15:26421016-26421038 CAGGACTTCCCAGAGAAGAAGGG + Intergenic
1124333526 15:28840554-28840576 AGAGGCTTCCAGGAGGAGGAGGG + Intergenic
1124612357 15:31216680-31216702 CAGAACCTCCAGGAGCAGGGTGG + Intergenic
1125262698 15:37845963-37845985 CAGGACCTCCAAGAGGAGAGTGG + Intergenic
1125908448 15:43415065-43415087 CAGAATTTCCAGGAAGAAGATGG + Intronic
1126499403 15:49327972-49327994 CACGACTTACTGGAGCAGGATGG + Exonic
1127673485 15:61217907-61217929 TATGACTTCAGGGAGGAGGAGGG - Intronic
1128177934 15:65573143-65573165 CAGGTTTTCCATGAGGAGCAGGG - Intronic
1128672621 15:69585963-69585985 CAGGACTTCCAGAACATGGAGGG - Intergenic
1128705296 15:69833894-69833916 GAGGACTTCCAGGGAGAGGTGGG - Intergenic
1128729913 15:70014128-70014150 GAGGCCTTCCTGGAGGAGGACGG - Intergenic
1129108421 15:73323915-73323937 CTGGACTTTGTGGAGGAGGATGG + Exonic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1129168920 15:73796146-73796168 GAGCGCTTCCTGGAGGAGGAAGG - Intergenic
1129253157 15:74319624-74319646 GGGGTCTTCCTGGAGGAGGAGGG + Intronic
1129761130 15:78130000-78130022 TAGGGCTTCTAGGAGGAGAAGGG + Intronic
1130064471 15:80592722-80592744 AAGGCCTTACAGAAGGAGGAAGG - Intronic
1131051895 15:89353938-89353960 AAGGACTTCCAGGAGAACTAGGG + Intergenic
1131149040 15:90035439-90035461 CAGGACTCCCAGGGCTAGGAGGG + Intronic
1131283942 15:91042357-91042379 CAGGACCTTCAGGAAGGGGAGGG - Intergenic
1131383762 15:91985912-91985934 GAGGCCTTCGAGGAGCAGGATGG + Intronic
1132450837 15:101967515-101967537 GAGGACTTTCAGGAAGAGGTGGG - Intergenic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132465775 16:76904-76926 CAGGACTTCCTGGGGAGGGAGGG - Intergenic
1132558786 16:584232-584254 CAGGGCCTCCAGCAGGAGGCCGG - Intergenic
1132574679 16:658975-658997 CAGGACATCCCAGAGGAAGACGG - Exonic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132762924 16:1519717-1519739 GAGGGCTCCCAGGAGGAGGTGGG + Intronic
1132897990 16:2237980-2238002 CACGACTTCCAGGAGGAATTCGG + Exonic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133021011 16:2966966-2966988 CCGGACTTCCCGGACGAGTACGG + Exonic
1133464697 16:6018810-6018832 GGGGACTACCAGGACGAGGACGG + Intergenic
1133904974 16:10013848-10013870 CTGGATTTCTAGGAAGAGGAAGG - Intronic
1135977494 16:27118592-27118614 CTGGAATGCAAGGAGGAGGATGG + Intergenic
1136192280 16:28623597-28623619 CAGGAGCTCCTGGAGGAGGCAGG - Intronic
1136748737 16:32614610-32614632 CAGGCCCTACAGGACGAGGAGGG + Intergenic
1137776415 16:51058415-51058437 CAGGAAATCCAGGAGCAGAATGG + Intergenic
1138108326 16:54303742-54303764 CATGACTTTCAGGGGGTGGATGG + Intergenic
1138148264 16:54631571-54631593 CATGAATTCCAGGCGAAGGAAGG + Intergenic
1138273190 16:55710636-55710658 CTGGAGTTCCAGGAGGACCAAGG + Intergenic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1138537326 16:57666967-57666989 CAGATCTTCCAGGAGAAGGCTGG + Intergenic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138945383 16:61843009-61843031 CAGGACCTGCTGGAGGTGGATGG + Intronic
1139357607 16:66376640-66376662 CAGGACTGACAGGAGAGGGAAGG - Intronic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1140297941 16:73727057-73727079 CAGGCCATCCAGGAGGACTAGGG + Intergenic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1140898484 16:79347169-79347191 CAGAACTTCCATGAGAAAGAAGG + Intergenic
1141466034 16:84206383-84206405 CAAGAATTCCTGGAGGAGGGAGG - Intergenic
1141617404 16:85217799-85217821 GAGGGCTTCGAGGAGGAGGCAGG - Intergenic
1141633836 16:85303428-85303450 GAGGGCTTCCTGCAGGAGGAGGG - Intergenic
1141656305 16:85418481-85418503 GAGGGCTTCCTGGAGGAGGCGGG - Intergenic
1142374090 16:89697902-89697924 CGGGACTTGCAGGAAGACGAGGG - Exonic
1203050871 16_KI270728v1_random:873824-873846 CAGGCCCTACAGGACGAGGAGGG + Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142709629 17:1716021-1716043 CAGCCCTTCCGGGAGGAGAAGGG - Intergenic
1143383097 17:6508530-6508552 TAGTGCTTCCTGGAGGAGGAAGG + Intronic
1143964978 17:10750619-10750641 CAGGACTGCCAGGAAGAGATGGG - Intergenic
1144194008 17:12873326-12873348 AAAGGCTTCCTGGAGGAGGAGGG - Intronic
1144678465 17:17176837-17176859 CAGGAGTCCCTGGAGGAGGCTGG - Intronic
1144730328 17:17522291-17522313 CAGGAAGTTCAGGAGCAGGATGG + Exonic
1144765782 17:17731697-17731719 CAGCAGCTCCAGGAGGAGGGAGG - Intronic
1144807516 17:17977671-17977693 CAGGGCCCCCAGGAGGAGGCCGG + Exonic
1146081224 17:29782478-29782500 CATGACTTCCAGAAGGAGTCTGG - Intronic
1146185195 17:30720071-30720093 GAGGGCTTCCTGGAGGAGGTGGG + Intergenic
1146795714 17:35779158-35779180 CCAGGCTTCCAGGAGGAGGGAGG + Intronic
1147332724 17:39708318-39708340 CAGGATATCCAGGAGGTGCAGGG + Exonic
1147568201 17:41550588-41550610 GGGGACTTCTAGGAGGGGGAGGG - Intergenic
1147757710 17:42779876-42779898 CAGGACTTCCATGAGGGAGATGG - Intergenic
1147862806 17:43533434-43533456 CAGGGATTACAGGAGAAGGAAGG + Intronic
1147949542 17:44099332-44099354 CACCACTCCCAGGAGAAGGAAGG - Intronic
1148155553 17:45423490-45423512 GAGTGCTTCCTGGAGGAGGAAGG - Intronic
1148236158 17:45970617-45970639 CAGGAGCTCTAGGAGGAGGCAGG + Intronic
1150387240 17:64772147-64772169 GAGTGCTTCCTGGAGGAGGAAGG - Intergenic
1150599105 17:66635038-66635060 AGAGACTTCCTGGAGGAGGAAGG + Intronic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1151675602 17:75595844-75595866 CAGGACAGCCAGGAGGGGGCTGG + Intergenic
1151898903 17:76998734-76998756 CAGGATTTACAGCAGGATGAAGG - Intergenic
1152009763 17:77705172-77705194 AAAGACTACCAGGAGGAGGAAGG - Intergenic
1152286498 17:79415986-79416008 CCAGAATTCCAGGAGGAGGCTGG + Intronic
1152646881 17:81473297-81473319 GAGGAGTTCGAGGAAGAGGAGGG + Intergenic
1152701344 17:81821454-81821476 CCAGATTCCCAGGAGGAGGAGGG - Intergenic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1153508725 18:5830430-5830452 CCAGAGTTCCAGGAGGGGGAGGG - Intergenic
1153522759 18:5967810-5967832 CAGGACTCCCTGGGGCAGGAGGG + Intronic
1153755254 18:8276129-8276151 GAAGACTTCAAGGAGGAGGCAGG - Intronic
1153829869 18:8912648-8912670 CCGGGCTGCCAGGAGGAGGAGGG - Intergenic
1153968179 18:10200868-10200890 CAGAACTTCCAGCATGGGGAGGG + Intergenic
1154173520 18:12067515-12067537 CGGGACCCCCAGGAGGAGGTGGG - Intergenic
1154948528 18:21185495-21185517 CTGGACTTCCAGGAGGTGCTAGG - Intergenic
1155471865 18:26199995-26200017 CATGACCTCCAGGAAGGGGAGGG - Intergenic
1155819208 18:30353119-30353141 CAGGACTACCAGCTGCAGGAAGG + Intergenic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156453626 18:37280590-37280612 GATGGCTTCCAGGAGGAGGTGGG + Intronic
1156460073 18:37316658-37316680 AAGGGCTTCCTGGAGGAGGTGGG - Intronic
1156909886 18:42399305-42399327 CAAGACTTCAAGGGGGAGGTAGG + Intergenic
1157294790 18:46434810-46434832 GAGGCCTTCCTGGAGGAGGAAGG + Intronic
1158681663 18:59573073-59573095 CAGGAGTTCCAGGACCAGGCAGG + Intronic
1159863393 18:73675535-73675557 AAGGAGTTTCAGGAAGAGGAGGG - Intergenic
1160225694 18:77009201-77009223 GAGGACAGCCAGGAGGAGAAGGG - Intronic
1160634425 19:65032-65054 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
1160696326 19:486359-486381 AAGGCCTTCCTGGAGGGGGAGGG - Intergenic
1160710299 19:548359-548381 GAGGGCTTCCTGGAGGAGGTGGG + Intronic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1161500181 19:4610246-4610268 CAGGACCTCTAGGCAGAGGAAGG + Intergenic
1162548529 19:11345609-11345631 CAGGACTGCAAGATGGAGGAAGG - Exonic
1164836466 19:31358038-31358060 CAGGACCTCCAGGAAGAGCTGGG - Intergenic
1165103806 19:33456892-33456914 CAGGACCTCCCGGAGGAAGACGG + Intronic
1165467369 19:35982891-35982913 CAGCAGGTACAGGAGGAGGAAGG - Intergenic
1165741868 19:38209696-38209718 CGGGGCCTCGAGGAGGAGGAGGG - Intergenic
1166717034 19:44975153-44975175 GAGGGCTTCCTGGAGGAGGTTGG - Intronic
1167169453 19:47821670-47821692 AAGGACTTCCCTGAGGAGTAGGG + Intronic
1167342320 19:48923045-48923067 CAAGAGGTCCAGGAGGAGGCTGG - Exonic
1167446213 19:49539105-49539127 CAGGGTTTCCTGGAGGAGAAAGG - Exonic
1167697555 19:51024263-51024285 CACAACCTCCAGAAGGAGGAGGG - Exonic
1167776500 19:51561103-51561125 GAGGTCTCCCTGGAGGAGGAGGG + Intergenic
1168307379 19:55442834-55442856 CAGGAGTACGAGGAGCAGGAGGG + Exonic
1202659840 1_KI270708v1_random:58071-58093 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
925020574 2:564711-564733 AAGGAGGTGCAGGAGGAGGAGGG - Intergenic
925622852 2:5810880-5810902 AAAGTCTTCCTGGAGGAGGAGGG + Intergenic
925746650 2:7049193-7049215 CTGGCCTTCCAGGCAGAGGAGGG + Intronic
926971733 2:18473556-18473578 CAGGCCTTCCAGGGGTAAGAGGG - Intergenic
927066127 2:19472753-19472775 CAGGATTTCAATGAGGATGATGG - Intergenic
927149057 2:20185442-20185464 AAGGGCTTCCAGGAAGAGGCAGG - Intergenic
927203996 2:20595494-20595516 GAGGGCTTCCTGGAGGAGGGAGG + Intronic
927471505 2:23380983-23381005 GATGCCTTCCTGGAGGAGGAAGG - Intergenic
928108841 2:28490295-28490317 CAGGACTGCCAGGAGGGGCTTGG + Intronic
928117916 2:28560992-28561014 CAGGAATAACAGGAGGATGAGGG - Intronic
928415602 2:31089137-31089159 TAGGATTTCAAGGAGAAGGAGGG - Intronic
929373746 2:41258921-41258943 CAGGACTTTCAGGAGTGGCAGGG - Intergenic
929564861 2:42977960-42977982 GTGGACTTCTTGGAGGAGGAAGG + Intergenic
929948411 2:46387991-46388013 CAGCACCCCCAGGAGCAGGAGGG - Intergenic
929959716 2:46487440-46487462 CAGGAATTAAAGGAGGAGGAAGG - Intergenic
931027443 2:58128260-58128282 CAGGACTTCCATAGTGAGGAAGG - Intronic
932192411 2:69752063-69752085 GAAGGCTTCCTGGAGGAGGAAGG + Intronic
932421134 2:71602112-71602134 CAAGACCTCCAGAAGAAGGAAGG - Intronic
934097913 2:88624682-88624704 CAGGACATCCAGAGGGAGGTAGG - Intronic
934991562 2:98925183-98925205 TGGGACTTCAAGGAGGAGGAAGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
937020473 2:118646336-118646358 CTGGAATTACAGGAGGAGGTGGG + Intergenic
937953979 2:127408723-127408745 GAAGACTTCCTGGAGGAGGCGGG - Intergenic
938003153 2:127762693-127762715 AAGGACTGCCAGGAGAATGACGG + Intronic
938082738 2:128378866-128378888 GCTCACTTCCAGGAGGAGGAAGG + Intergenic
938302697 2:130228285-130228307 GGGGGCTTCCCGGAGGAGGAAGG - Intergenic
938343796 2:130552358-130552380 CAGGAGGCCCAGGTGGAGGAGGG - Intergenic
938346037 2:130568364-130568386 CAGGAGGCCCAGGTGGAGGAGGG + Intergenic
938814461 2:134886107-134886129 CTGGAATTCCAGGAATAGGATGG + Intronic
938934213 2:136115118-136115140 GATGATTTCCAGGAGGATGAAGG + Exonic
938967605 2:136402246-136402268 CAGGAATCCCAGGAGGAGGTTGG - Intergenic
939045617 2:137246155-137246177 GAAGAGATCCAGGAGGAGGATGG + Intronic
939510004 2:143093437-143093459 TAGGACTATTAGGAGGAGGAGGG + Intronic
940891724 2:159042116-159042138 CAGGACTTCAAAGATGAGAACGG - Intronic
941716975 2:168774282-168774304 CAGGAACTCCAGGAGGCTGAAGG - Exonic
941916914 2:170818910-170818932 GAGGGCTTCGCGGAGGAGGAGGG + Intronic
942068783 2:172296550-172296572 CAGTAGGTCCAGGAGGAGGTGGG - Intergenic
942386233 2:175446364-175446386 CAGGACAGCCAGGGGAAGGAGGG - Intergenic
943337674 2:186638286-186638308 CAGGAGTTCCAAGAGCAGCAAGG + Exonic
943445295 2:187977870-187977892 CTGGTGTTGCAGGAGGAGGAAGG + Intergenic
943772599 2:191734567-191734589 AAGGACTTAAAGGAGGAGAAAGG - Intergenic
943928472 2:193819486-193819508 CAGGACTACCAGTAGCAGGATGG - Intergenic
944863874 2:203841449-203841471 CAGGGCTTCCAGAGGGTGGAGGG + Intergenic
946335851 2:219036031-219036053 CAGGACTGGGAGGAGGAAGAGGG - Intronic
948225591 2:236307088-236307110 AAGGACTCACATGAGGAGGAAGG - Intergenic
948334638 2:237198160-237198182 CAGGACTCCTAGTAGGAGAATGG - Intergenic
948377281 2:237529850-237529872 CAGCTCTCCCAGGAGGAGGGAGG - Intronic
948384999 2:237575706-237575728 CAGGCCCTGCAGGAGGAGGAAGG - Intronic
948434558 2:237944271-237944293 CAGGACTACCAGCTGCAGGAAGG + Intergenic
949050788 2:241896344-241896366 CAAGTCTGCTAGGAGGAGGAAGG + Intronic
1169062583 20:2672410-2672432 CATGACTTTCTGGAAGAGGAAGG + Intergenic
1169394091 20:5214499-5214521 CAGGATTTCCAGAAGGTGCATGG + Intergenic
1169701333 20:8450154-8450176 GAGCACTTCCAGGAGTAGGATGG - Intronic
1170327880 20:15176499-15176521 CAGGACTACCAGCTGCAGGAAGG + Intronic
1170554481 20:17504540-17504562 AGGGGCTTCCAGGAGGAGGCAGG + Intronic
1172595928 20:36151183-36151205 CAGGAAAGCCAGGAGGAGAACGG - Intronic
1172671258 20:36635769-36635791 CAGGGCTTCCAGGAGGGGAAGGG - Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173663570 20:44750555-44750577 CAGGACCACCAGGTTGAGGAAGG - Exonic
1173795746 20:45858037-45858059 GAGGGCTGCCTGGAGGAGGAGGG + Intronic
1174144673 20:48443398-48443420 AAAGACCTCCAGGAGGAGCAGGG + Intergenic
1174507099 20:51023710-51023732 CAGGACTTCCAGGGAAAGGCAGG - Intergenic
1174725722 20:52859678-52859700 GAGGTCTTCCTGGAAGAGGAGGG - Intergenic
1175249593 20:57601205-57601227 GAAGGCTTCCTGGAGGAGGAGGG - Intergenic
1175551662 20:59821875-59821897 CAGGAAGTTGAGGAGGAGGAGGG + Intronic
1175923958 20:62462984-62463006 GAAGGCTTCCAGGAGGAGGTGGG + Intergenic
1176051273 20:63120852-63120874 GAGGACTTTGGGGAGGAGGATGG - Intergenic
1176079970 20:63267604-63267626 CAGGACCTCCAGAGGGAGCACGG - Intronic
1176139267 20:63537971-63537993 GAGGACTTCCCGGAAGAGGAGGG + Intergenic
1176986588 21:15444660-15444682 GAGTCCTTCCAAGAGGAGGATGG - Intergenic
1177046084 21:16171889-16171911 CAAGACTTCAGGGAGGAGGCCGG - Intergenic
1178172152 21:30053416-30053438 CATGACCACCTGGAGGAGGAAGG - Intergenic
1178943223 21:36924994-36925016 AAGGACTTCCCGGAGTAGAAGGG + Intronic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179731076 21:43367766-43367788 AAGGCCTTCCAGGCTGAGGAAGG + Intergenic
1179942142 21:44647233-44647255 CTGGACTGGCAGGAGGAGGTGGG - Exonic
1180327314 22:11441633-11441655 TAGTACTTGCAGGAGGTGGAAGG - Intergenic
1180600495 22:17012293-17012315 GAGGGCTTCTTGGAGGAGGAGGG + Intergenic
1180829630 22:18897217-18897239 TAGGACTGCTAGGAGGGGGAGGG - Intergenic
1181103222 22:20555352-20555374 CAGGGCTAGGAGGAGGAGGAGGG - Intronic
1182699092 22:32218541-32218563 CACCACAGCCAGGAGGAGGATGG + Exonic
1182851428 22:33477962-33477984 GAGGGCTTCCAGGAAAAGGAAGG - Intronic
1183525467 22:38319858-38319880 CAGGTCTTCCAGGGATAGGAAGG - Intronic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
1183936887 22:41267740-41267762 CAGGACTGCGAGGTGCAGGAAGG + Intronic
1184049337 22:41992586-41992608 CTGGACTTTCAGGAGCAGGATGG - Intronic
1184080100 22:42213320-42213342 CAGAGCCTCCAGGAGGAGGAGGG - Exonic
1184311765 22:43650137-43650159 CAGGACCTCCTGGAGGGGAAGGG + Intronic
1184440532 22:44510044-44510066 AAAGGCTTCCAGGAGGAGGTGGG + Intergenic
1184450490 22:44579677-44579699 CAGGGCTTCCTGGAGGAGGTGGG - Intergenic
1184684800 22:46091415-46091437 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684836 22:46091559-46091581 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184684845 22:46091595-46091617 GAGGGCTTCCTGGAGGAAGAGGG - Intronic
1184738808 22:46415102-46415124 CAGGAGCTCAGGGAGGAGGATGG + Intronic
1185050893 22:48553466-48553488 CTGGACACCCAGGAGGAGGATGG + Intronic
1185117813 22:48947904-48947926 CAGAACCTCCAGGGTGAGGACGG + Intergenic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
1185310286 22:50150516-50150538 CAGGACTTCGGGGAGGCAGATGG + Intronic
1203279721 22_KI270734v1_random:122489-122511 TAGGACTGCTAGGAGGGGGAGGG - Intergenic
949495713 3:4629806-4629828 GAGGGCTTCCTGGAGGAAGAAGG + Intronic
949914633 3:8949957-8949979 CAGTCCTTCCAGGAGTAGGAGGG + Intronic
952838957 3:37628229-37628251 AAGGACTTCCAAGTGGAGCAGGG - Intronic
953483685 3:43274484-43274506 CTGGACTTCCAAGAGGAGCGGGG - Intergenic
953813231 3:46132276-46132298 AAGGACCTCCAGGTGGAGGCTGG + Intergenic
954156419 3:48687336-48687358 GAGGGCTTCTGGGAGGAGGAAGG - Intergenic
955328243 3:58026153-58026175 CAGGGCTTCTTGGAGGAGGGTGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
958183802 3:90092746-90092768 CATGTCTTCCAGGAGGCAGAGGG + Intergenic
958442869 3:94177923-94177945 CGGAACTTGGAGGAGGAGGAAGG + Intergenic
959664135 3:108902688-108902710 CAGCTGGTCCAGGAGGAGGACGG - Intergenic
961093972 3:124139037-124139059 GAGGACTTGCAGCAGGAGGCTGG + Intronic
961147091 3:124603328-124603350 CAAGGCTACCAGGAGGAGGCAGG - Intronic
961339254 3:126206110-126206132 TATGACCTCCAGGAGGAGGCAGG - Intergenic
962484799 3:135831991-135832013 CAGGACTTCAAGTAACAGGATGG + Intergenic
963035324 3:141020651-141020673 GATGGCTTCCAAGAGGAGGAAGG + Intergenic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963320282 3:143803205-143803227 TGTGACTTCCAGGAGGAAGAGGG - Intronic
964419539 3:156486688-156486710 CAGGGCCTCCTGGAGGATGAAGG + Intronic
965537720 3:169841268-169841290 CAGGGCTGCCAGGAGGAAGAAGG - Intronic
967337898 3:188364613-188364635 GAAGACTTTCTGGAGGAGGAGGG + Intronic
967393547 3:188981215-188981237 CAGGACTTCAACAAGGGGGAGGG + Intronic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
967925692 3:194644707-194644729 GATCTCTTCCAGGAGGAGGATGG + Exonic
968564546 4:1304089-1304111 CACGACTGACAGGGGGAGGAGGG - Intronic
968872128 4:3247475-3247497 CAGGGCTTCCTAGAGGAGGTAGG + Exonic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
970565260 4:17325912-17325934 CAAAAGTTCCAGGAGGAGGAAGG + Intergenic
970694247 4:18657826-18657848 CGGGTCTACCAGGAGAAGGATGG - Intergenic
971264127 4:25083215-25083237 CAGGACTGCGAGGAGGGGAAGGG + Intergenic
971449155 4:26784033-26784055 CAGGGCTTCCAGGAGGATGGAGG - Intergenic
972344104 4:38178285-38178307 CAGGTCTTGCAGGAAGAGTAAGG + Intergenic
973981824 4:56314301-56314323 CAGGAGCTCTTGGAGGAGGAGGG + Exonic
975096473 4:70462859-70462881 CAGGAACTGCAGCAGGAGGATGG + Intronic
975618748 4:76274687-76274709 TAGGTTTTCCAGGAGGAAGAAGG + Intronic
976348955 4:84038652-84038674 CAGGACTCCCAGGAATAGAATGG - Intergenic
976874520 4:89837160-89837182 GAGGACTAGGAGGAGGAGGACGG - Intronic
978410354 4:108418343-108418365 CTGGACTTCCAGGAGATGGTGGG - Intergenic
978578006 4:110205328-110205350 CAGGAGTTCAAGGATGAGGTGGG - Intergenic
979244231 4:118481220-118481242 CAAGACTTCCAGGAGATGAATGG + Intergenic
979497350 4:121398191-121398213 CAGATCTTCCAGCAGGAGAATGG + Intergenic
980878662 4:138687411-138687433 CAAAACTTCAAGGAGGAGGTAGG - Intergenic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
982290754 4:153780139-153780161 CTGGAATGCAAGGAGGAGGAAGG - Intergenic
982802578 4:159722925-159722947 CAGGACTACCAGCTGCAGGAAGG - Intergenic
983486374 4:168335788-168335810 CAGGAATTCCAGCAGCAGGCTGG - Intergenic
984962159 4:185108381-185108403 CCGGAATTCCAAAAGGAGGAGGG + Intergenic
985617303 5:931146-931168 CAGGACTTGCAAGAAGTGGATGG + Intergenic
985735383 5:1577124-1577146 CAGGTCTTCAAGGAGAGGGAGGG + Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
986392303 5:7298086-7298108 AGAGGCTTCCAGGAGGAGGAGGG + Intergenic
986427071 5:7644267-7644289 GAGGAAATCAAGGAGGAGGATGG - Intronic
986534424 5:8772192-8772214 TAGGATTTTGAGGAGGAGGAAGG + Intergenic
986732464 5:10645372-10645394 CAGGACTAGCAGGAGGTGGGTGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
988702043 5:33685239-33685261 GAAAACTTCCAGCAGGAGGAAGG + Intronic
989158974 5:38371939-38371961 CAGGAGTTCCATGGGGAGGGTGG - Intronic
990970644 5:61502197-61502219 CAGGGATGCCAGGAGCAGGAAGG + Intronic
991471372 5:66972561-66972583 CAGGACTTCCTAGTGGATGATGG - Intronic
992102056 5:73417589-73417611 GAGGAATTCCTGGAGGAGGGAGG + Intergenic
994242205 5:97437138-97437160 CAGGGCTTCCAGGACAGGGATGG - Intergenic
995687956 5:114791683-114791705 CAGGAGATCCAGGTAGAGGATGG + Intergenic
997423511 5:133787476-133787498 CATGTCTTCCTGGAGGAGCACGG + Intergenic
997436629 5:133880387-133880409 GAGGGCTTCCTGGAGGAGGCAGG - Intergenic
997606232 5:135177443-135177465 CAGGCCCTACTGGAGGAGGAAGG - Intronic
998140403 5:139696866-139696888 CAGGACCTGCAGGAGCAGAACGG + Intergenic
998354354 5:141522383-141522405 CAGAACTCACAGGTGGAGGAAGG - Intronic
998402559 5:141855620-141855642 AAGGTCTTGCAGGAGGAGGGTGG - Intronic
999247369 5:150162292-150162314 GAGGGCTTCCAGGGGGAAGAGGG + Intergenic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
999629096 5:153551732-153551754 CAGGGGTTCAGGGAGGAGGATGG - Intronic
1001977309 5:176010428-176010450 CAGGACATGCAGCAGGAGTATGG - Intronic
1001990613 5:176112986-176113008 CAGGCCCTACAGGAGGAGAAGGG + Intronic
1002047641 5:176550768-176550790 CAGGACCTCCAGGAGGGTCAGGG - Intronic
1002226260 5:177725154-177725176 CAGGCCCTACAGGAGGAGAAGGG - Intronic
1002240117 5:177833352-177833374 CAGGACATGCAGCAGGAGTATGG + Intergenic
1002267591 5:178046059-178046081 CAGGCCCTACAGGAGGAGAAGGG + Intronic
1002329655 5:178432804-178432826 CAGGACCTCAAGGAAGAGCAGGG - Intronic
1002884989 6:1285645-1285667 CAGGACTTCCAAGAGGCAGAAGG - Intergenic
1003097404 6:3153879-3153901 GGGGAGTTCGAGGAGGAGGAGGG - Exonic
1003106944 6:3224767-3224789 GGGGAGTTCGAGGAGGAGGAGGG - Exonic
1005015990 6:21375984-21376006 CAGGCTTTCCAGGAGCAGCATGG + Intergenic
1006338154 6:33431686-33431708 CAGGGGTTCCAGGAGGTGGGGGG + Intronic
1006515877 6:34545298-34545320 CAGGCTTTCCAGGAGGAGCCAGG + Intronic
1007283503 6:40730293-40730315 CAGGACCTGGAGGAGGGGGATGG + Intergenic
1007724962 6:43910091-43910113 CTGGACTTGCAGGTGAAGGAGGG - Intergenic
1007755716 6:44097974-44097996 GATGACTTCCTGGGGGAGGAGGG - Intergenic
1008231620 6:48990311-48990333 CAGGACTACCAGCAGTTGGAAGG + Intergenic
1009472409 6:64043989-64044011 CAGGAGTTGCAGGGGAAGGAAGG - Intronic
1013181258 6:107718695-107718717 CAGGATTTCCAGCAGTAAGAGGG - Intronic
1013422279 6:109978069-109978091 CAGAACTTCCAGGAATGGGATGG - Intergenic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013817968 6:114121937-114121959 CAGGACTTCCAGCAGGAAGAAGG - Intronic
1014274170 6:119368101-119368123 CAGGACTACTAGAAGCAGGAGGG + Intergenic
1015526042 6:134175866-134175888 CAGAACTTGGAAGAGGAGGAAGG + Intronic
1015618463 6:135104558-135104580 TAGGACTTCCAGGATGATGTTGG - Intergenic
1016353802 6:143195725-143195747 GAGCACTTCCAGAAGGAGGCAGG + Intronic
1017375812 6:153766732-153766754 CAGGAATTACAGGAGCAGTAGGG - Intergenic
1017894003 6:158663562-158663584 GAGGACGCTCAGGAGGAGGAGGG + Intronic
1018935811 6:168273516-168273538 CCTGGCTTCCAGGAGGAGGAAGG + Intergenic
1018958557 6:168430494-168430516 CTGGACTTCCAGGAGGCAGCAGG + Intergenic
1019494609 7:1331978-1332000 CAGGACATTCTGAAGGAGGAGGG + Intergenic
1019777251 7:2919192-2919214 AAGGGCTTCCTGGAGGAGGAGGG + Intronic
1020100838 7:5393598-5393620 CAGGACACCTGGGAGGAGGAAGG + Intronic
1020114148 7:5466345-5466367 CAGCACCTCCAGGAGGAGCACGG - Intronic
1020410262 7:7884468-7884490 TTGAACTTCAAGGAGGAGGAAGG + Intronic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1023843041 7:44107408-44107430 CAGGAGTTCCAGAAGCAGGTGGG - Intronic
1025088189 7:56040615-56040637 CATAATTTCTAGGAGGAGGAAGG - Intronic
1025900219 7:65738344-65738366 CATAATTTCTAGGAGGAGGAAGG - Intergenic
1026370149 7:69691070-69691092 CAGGACTACCAGCTGCAGGAAGG - Intronic
1026963720 7:74426045-74426067 GATGACTTCCTGGAGGAGGCAGG + Intergenic
1027151008 7:75733636-75733658 CAAGGCTTCCTGGAGGAGGCTGG + Intronic
1027190969 7:75995232-75995254 CAGGCCTTCAAGGAGGAGTGGGG - Intergenic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1027297828 7:76796266-76796288 AAGGACTTGGAGGAGGAGAATGG - Intergenic
1027499523 7:78931338-78931360 CAGTTATTCCAGGAGGAAGAGGG - Intronic
1029179279 7:98688266-98688288 GGGGGCTTCCAGGAGGAGGTGGG + Intergenic
1029365156 7:100111991-100112013 CAGGGCTTCCTGTGGGAGGAGGG + Exonic
1029641951 7:101826602-101826624 CAGGACTGGCAGGACGAGGCTGG + Intronic
1030632074 7:111907032-111907054 GAGACCTTCAAGGAGGAGGAAGG + Intronic
1031082975 7:117276240-117276262 CAGTTCATCCAGCAGGAGGAAGG + Intergenic
1031995766 7:128229871-128229893 CAGGCCTTTCAGGAGGAGGGAGG + Intergenic
1033399948 7:141013203-141013225 CAAGATAGCCAGGAGGAGGAAGG + Intronic
1034259313 7:149744900-149744922 CAGGACTGCCACGAGGTGGATGG - Intergenic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1034506188 7:151493257-151493279 CAGGAACTCCAGGAGCAGAAGGG - Intronic
1034536153 7:151727303-151727325 TGGGACCTCCAGGAGGAGGCAGG + Intronic
1034659801 7:152759513-152759535 GAAGACTTACAGGAGGAGAAAGG + Intergenic
1035291680 7:157843462-157843484 GAGGAGCTCCAGGTGGAGGAAGG - Intronic
1036155114 8:6334585-6334607 TATGATTTCCAGGAGGAGAAGGG - Intergenic
1036229299 8:6985884-6985906 CAGGAATTCCAGGTGGTGGCAGG + Intergenic
1036231751 8:7004988-7005010 CAGGAATTCCAGGTGGTGGCAGG + Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1036787584 8:11698092-11698114 CAGGACCTCCTGGGAGAGGACGG - Intronic
1036907655 8:12720546-12720568 CAGGACTACCAGCTGCAGGAAGG + Intergenic
1037567093 8:20127083-20127105 CCGGGCTTCCAGGAACAGGAAGG + Intergenic
1037572607 8:20171421-20171443 CAGGAAGGCCAGGATGAGGAAGG + Exonic
1038035444 8:23682785-23682807 CAGGATGTCCTGGATGAGGAAGG + Exonic
1038401988 8:27290569-27290591 CAGGAAGTCCAGGAGCATGATGG - Intronic
1038578929 8:28730094-28730116 CTGGACCTCCAGGGGGAGGATGG + Intronic
1038768231 8:30450447-30450469 CTGGACTTTGAGGAGGAGGTGGG + Intronic
1039737420 8:40347711-40347733 CAGGAGGTCAAGAAGGAGGAAGG - Intergenic
1039796413 8:40919282-40919304 CGGGACTGCCAGGAGGGAGAAGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040550286 8:48432187-48432209 ATGGGCTTCCTGGAGGAGGAGGG + Intergenic
1040603789 8:48910145-48910167 CGTGACTTCCAGGAGGTGGGTGG - Intergenic
1040857914 8:51969547-51969569 GAGGACTCCAATGAGGAGGAAGG - Intergenic
1043214168 8:77564571-77564593 GAGGCCTTCCAGAAGGTGGAAGG + Intergenic
1043413725 8:80027978-80028000 CAGTTTTTCCAGGAGGAGGCTGG - Intronic
1045065460 8:98439997-98440019 TAGGACTTGCAGGGAGAGGAGGG + Intronic
1045268750 8:100643954-100643976 GAGGACTTCCTGGAGGAGATGGG + Intronic
1046712775 8:117530454-117530476 CAATACTTCCAGCAGGAAGATGG - Intronic
1047224971 8:122948297-122948319 CCCGACTTCCAGGAAAAGGAAGG - Intronic
1047249169 8:123168861-123168883 CAGAATTTCCAGGAGGATCAGGG + Intergenic
1047451310 8:124967363-124967385 CAGAACTTCCAGCTGGAGGATGG - Intergenic
1048339093 8:133525309-133525331 CAGGACTACCAGCTGCAGGAAGG - Intronic
1048444126 8:134480669-134480691 CATGACTCCCAGGAGGTGTAGGG + Intronic
1048852811 8:138660451-138660473 CAGGAAATCCAGGAGAAAGAGGG - Exonic
1049199707 8:141334087-141334109 AAGGACTTCCTGGAGGAGGAGGG + Intergenic
1049309512 8:141925889-141925911 TAGGACTTCCAGGAGGAGGGAGG + Intergenic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1049434693 8:142581104-142581126 CAGGTCTTCCAGGAGAGGGTGGG + Intergenic
1049651726 8:143772693-143772715 CAGGACTTCCAGGAAGGGAATGG - Intergenic
1049885480 9:23537-23559 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
1051288586 9:15522281-15522303 GTGAACTTCTAGGAGGAGGAAGG - Intergenic
1052772634 9:32703657-32703679 GAGTACTTAAAGGAGGAGGAGGG - Intergenic
1052986532 9:34491961-34491983 GAGGACTTGAAGGGGGAGGAGGG - Intronic
1053139883 9:35675854-35675876 CAGGAGTTCCAGGGGGCGCAGGG - Exonic
1053160426 9:35810136-35810158 GAGGAGTGCCAGGATGAGGATGG + Intronic
1053298854 9:36934660-36934682 GAGGGCTTCCTGGAAGAGGAAGG - Intronic
1054766826 9:69049027-69049049 CAGAACTGCCAGAAGGAGTAAGG - Intronic
1055709588 9:79045458-79045480 AAGTACTCCCAGGTGGAGGAGGG - Intergenic
1056203239 9:84296550-84296572 AGGGACTTCCCAGAGGAGGATGG + Intronic
1056566120 9:87774081-87774103 CATGTTGTCCAGGAGGAGGATGG + Intergenic
1057004284 9:91543244-91543266 CACGTCTTCCTGGAGGAGGCAGG + Intergenic
1057179581 9:93022487-93022509 CAGGGCCTCCTGGAGGCGGAGGG + Intronic
1057307478 9:93920630-93920652 CAGGCCCACGAGGAGGAGGAGGG + Intergenic
1057809940 9:98250111-98250133 GAAGGCTTCCAGGAGGAGGCTGG + Intronic
1058702098 9:107609675-107609697 CAGGGCTTCCAGGATGAGAAAGG - Intergenic
1059469741 9:114495710-114495732 AAGGACTTGCAGGAGGAGAGGGG + Intronic
1059489631 9:114656459-114656481 CTGGGCTTCCATGAGGAAGAGGG - Intergenic
1059999852 9:119948405-119948427 CACTGGTTCCAGGAGGAGGATGG - Intergenic
1060340131 9:122767943-122767965 CAGAACTCCCTGGAGCAGGAAGG - Intergenic
1060736130 9:126067526-126067548 GAGGCCTTCCTGGAGGAGGAGGG - Intergenic
1060785884 9:126451386-126451408 CTGCACCTCCAGGTGGAGGAGGG + Intronic
1061180293 9:129021556-129021578 CAGGACTTCCGGGGAAAGGAGGG - Intronic
1061386966 9:130296105-130296127 CAGGGCTGGCAGGAAGAGGAGGG + Intronic
1061865786 9:133491152-133491174 GAGGACTTGGAGGAGGAGGGAGG + Intergenic
1062277616 9:135738164-135738186 GAGGGCTTCCTGGAGGAGGTGGG - Intronic
1062318865 9:135980845-135980867 CAGAACTTCCCAGAGGAGCAGGG + Intergenic
1062421883 9:136486597-136486619 GAGCTCTTCCTGGAGGAGGAGGG + Intergenic
1062473021 9:136714496-136714518 GAGGACAGCCAGGAGGAGGGAGG - Intronic
1062612996 9:137383346-137383368 CAGGGCCTGCAGGAGCAGGAGGG + Exonic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1203441894 Un_GL000219v1:16440-16462 CAGGACAGCCAGGAGGAGAGAGG - Intergenic
1203512702 Un_KI270741v1:135349-135371 CAGGACAGCCAGGAGGAGAGAGG - Intergenic
1185886773 X:3790169-3790191 AAGCAGTTCCAAGAGGAGGAAGG + Intergenic
1186425411 X:9460956-9460978 CAGGGGTTCAAGGAGGAAGAAGG - Intergenic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187224167 X:17359931-17359953 TATGACTTCCAGGAGGAGGATGG + Intergenic
1189074680 X:37903846-37903868 CAGTACTTCATGGAGGAGGCAGG - Intronic
1189140477 X:38600238-38600260 CAGCTCTTCCAGGAGGAAAACGG - Intronic
1189908143 X:45783030-45783052 CAGCACTCCCATGAGCAGGAAGG + Intergenic
1189975403 X:46456821-46456843 CAGGACTTCCTGTTGCAGGATGG + Intronic
1190468130 X:50747800-50747822 CAAGACTGGCAGGAGGAGAAGGG + Intronic
1192935777 X:75857530-75857552 TGCGACTTCCAGGAGGAAGAGGG + Intergenic
1193087638 X:77461334-77461356 CAGCCTTTTCAGGAGGAGGAAGG - Intergenic
1193094204 X:77528473-77528495 CAGCACTTGCAGGAGGCGGCTGG - Intronic
1193238845 X:79142520-79142542 CAAGTCTTCCAGGAGAAGAAGGG - Intergenic
1195656873 X:107340251-107340273 AAAGACTTCCAGAAGGAGGTGGG + Intergenic
1198069137 X:133130578-133130600 CAGTACTTCCAGCAGTGGGAAGG - Intergenic
1199271155 X:145883785-145883807 CAGGAGTTCTAGAAGTAGGAAGG + Intergenic
1200229988 X:154439050-154439072 CTGGACTTCAAGGTGGTGGAGGG + Exonic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic
1200921555 Y:8617965-8617987 CAGGTCTTGCTGGAGGAGGATGG - Intergenic
1201060298 Y:10038360-10038382 CAGTACTTCCAGAGGGAGGGAGG + Intergenic
1201264594 Y:12193756-12193778 CAGGTCCTCCAGGTGGAAGAAGG + Intergenic
1201604555 Y:15770961-15770983 CAGGACTTCCGGGGAAAGGAGGG + Intergenic
1201794741 Y:17882837-17882859 GTGGTCTTCAAGGAGGAGGAAGG - Intergenic
1201806814 Y:18023148-18023170 GTGGTCTTCAAGGAGGAGGAAGG + Intergenic
1202356116 Y:24050616-24050638 GTGGTCTTCAAGGAGGAGGAAGG - Intergenic
1202514662 Y:25619493-25619515 GTGGTCTTCAAGGAGGAGGAAGG + Intergenic