ID: 1027230065

View in Genome Browser
Species Human (GRCh38)
Location 7:76267465-76267487
Sequence GCACGGCGCAGCCCGCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 156}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027230065_1027230078 8 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230078 7:76267496-76267518 GCGGGTCGCCAGCGGGGCAGGGG 0: 1
1: 0
2: 1
3: 15
4: 255
1027230065_1027230083 27 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230083 7:76267515-76267537 GGGGGCGATAAGTGTGGCATGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1027230065_1027230074 1 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230074 7:76267489-76267511 TGGTCGGGCGGGTCGCCAGCGGG 0: 1
1: 0
2: 0
3: 8
4: 39
1027230065_1027230085 29 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230085 7:76267517-76267539 GGGCGATAAGTGTGGCATGGGGG 0: 1
1: 0
2: 0
3: 9
4: 164
1027230065_1027230084 28 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230084 7:76267516-76267538 GGGGCGATAAGTGTGGCATGGGG 0: 1
1: 0
2: 0
3: 5
4: 84
1027230065_1027230077 7 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230077 7:76267495-76267517 GGCGGGTCGCCAGCGGGGCAGGG 0: 1
1: 0
2: 0
3: 17
4: 235
1027230065_1027230071 -10 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230071 7:76267478-76267500 TGCGCCGTGCGTGGTCGGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 49
1027230065_1027230075 2 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230075 7:76267490-76267512 GGTCGGGCGGGTCGCCAGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 53
1027230065_1027230081 21 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230081 7:76267509-76267531 GGGGCAGGGGGCGATAAGTGTGG 0: 1
1: 0
2: 1
3: 12
4: 224
1027230065_1027230082 26 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230082 7:76267514-76267536 AGGGGGCGATAAGTGTGGCATGG 0: 1
1: 0
2: 0
3: 13
4: 101
1027230065_1027230079 9 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230079 7:76267497-76267519 CGGGTCGCCAGCGGGGCAGGGGG 0: 1
1: 0
2: 0
3: 16
4: 265
1027230065_1027230073 0 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230073 7:76267488-76267510 GTGGTCGGGCGGGTCGCCAGCGG 0: 1
1: 0
2: 0
3: 6
4: 53
1027230065_1027230076 6 Left 1027230065 7:76267465-76267487 CCGCGCCGCGGGCTGCGCCGTGC 0: 1
1: 0
2: 0
3: 24
4: 156
Right 1027230076 7:76267494-76267516 GGGCGGGTCGCCAGCGGGGCAGG 0: 1
1: 1
2: 0
3: 27
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027230065 Original CRISPR GCACGGCGCAGCCCGCGGCG CGG (reversed) Intronic