ID: 1027232698

View in Genome Browser
Species Human (GRCh38)
Location 7:76281843-76281865
Sequence TAGTGGAGGGGAGCCCTGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027232698_1027232716 27 Left 1027232698 7:76281843-76281865 CCGCACAGGGCTCCCCTCCACTA 0: 1
1: 0
2: 4
3: 25
4: 231
Right 1027232716 7:76281893-76281915 CCGCGCTGAGCTACCCTCCAGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1027232698_1027232704 -5 Left 1027232698 7:76281843-76281865 CCGCACAGGGCTCCCCTCCACTA 0: 1
1: 0
2: 4
3: 25
4: 231
Right 1027232704 7:76281861-76281883 CACTAGCGGATCCCTGCCCACGG 0: 1
1: 0
2: 0
3: 8
4: 71
1027232698_1027232705 -4 Left 1027232698 7:76281843-76281865 CCGCACAGGGCTCCCCTCCACTA 0: 1
1: 0
2: 4
3: 25
4: 231
Right 1027232705 7:76281862-76281884 ACTAGCGGATCCCTGCCCACGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1027232698_1027232714 26 Left 1027232698 7:76281843-76281865 CCGCACAGGGCTCCCCTCCACTA 0: 1
1: 0
2: 4
3: 25
4: 231
Right 1027232714 7:76281892-76281914 CCCGCGCTGAGCTACCCTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027232698 Original CRISPR TAGTGGAGGGGAGCCCTGTG CGG (reversed) Intronic
900343478 1:2199567-2199589 CAGAGGAGGGGTGCCCTGAGAGG - Intronic
901059552 1:6465770-6465792 TGGTGGAGGGGAAACTTGTGAGG - Intronic
906495583 1:46302337-46302359 GAGTGGAGGGGGGCCCGGAGCGG - Intronic
913203757 1:116517116-116517138 CAGTGGAGGGGAACTCTGAGTGG - Intronic
914694675 1:150066796-150066818 TGATAGAGGGGAGACCTGTGTGG + Intergenic
914873482 1:151494766-151494788 TATTGGAGGGCAGGCCTGTTAGG + Intergenic
915163268 1:153934030-153934052 GAGTGGAGGGCGGCCCTCTGTGG - Intronic
916417982 1:164610384-164610406 TAGTTGAGGGGGTCCCTGTTGGG + Intronic
917969045 1:180195659-180195681 TAGTTGGGGGGAGACCTGAGGGG - Intronic
920387907 1:205581072-205581094 TAGTGCAGGGGATCCCGGGGAGG - Intronic
920649242 1:207824373-207824395 TAGTACAGGGCAGCCCTGTCTGG - Intergenic
921951434 1:220934361-220934383 GAGTTGAGAGGAGCCCAGTGGGG - Intergenic
922545882 1:226456393-226456415 TAGAGGAGGGGGCCTCTGTGAGG + Intergenic
1062801926 10:387456-387478 GAGGGGAGGGGACTCCTGTGTGG + Intronic
1062801946 10:387527-387549 GAGGGGAGGGGACTCCTGTGTGG + Intronic
1064236791 10:13583392-13583414 GAGTGGACGGGTGCCCTTTGAGG + Intergenic
1066778760 10:38919522-38919544 GAGTGGAGTGGAGTGCTGTGGGG + Intergenic
1069291141 10:66781156-66781178 CAGTGCAGAGGAGCCCTGTGTGG + Intronic
1071522822 10:86341507-86341529 CCGTGGCCGGGAGCCCTGTGGGG - Intronic
1072533649 10:96343072-96343094 TCATGGAGGGCAGCTCTGTGTGG - Intergenic
1072551324 10:96479771-96479793 CACTGGAGGGCAGCCCTTTGGGG - Intronic
1073161238 10:101397998-101398020 TAGTGGAGTGGAGACATGTTAGG + Intronic
1073349115 10:102806806-102806828 TGGTGGAGGGCAGCTTTGTGAGG + Intronic
1074268680 10:111930832-111930854 TAGTTGAGAGAAGCCCTGTGGGG - Intergenic
1075118079 10:119643791-119643813 TAGTGGAAGGGCCCCCTGAGAGG + Intergenic
1075469245 10:122675841-122675863 TCATGGAGGGGAGCACTGAGAGG - Intergenic
1076191344 10:128485641-128485663 TGGTGGAGGTGGGCCCTGTGGGG - Intergenic
1076246215 10:128949610-128949632 AGTTGGAGGGAAGCCCTGTGAGG + Intergenic
1076566820 10:131404583-131404605 GATTGGAGGGAGGCCCTGTGGGG - Intergenic
1076633873 10:131870193-131870215 AAGTGCAGGTGAGCTCTGTGGGG + Intergenic
1077116056 11:885115-885137 GAGGGGAGGGGGTCCCTGTGAGG + Intronic
1079129315 11:17738238-17738260 AAGGGGAGGGAAGCCCTCTGAGG - Intronic
1081991589 11:47340928-47340950 GAGTGGAGGGGAGGCCTGCGTGG + Intronic
1085313677 11:75530871-75530893 GGGTGGAGGGGAGCCATGGGAGG + Intergenic
1085402928 11:76245372-76245394 TAGAGCAGGAGAGCACTGTGAGG + Intergenic
1088872687 11:113904845-113904867 GAGTGGAGAGGAACCCTGTTAGG + Exonic
1090262233 11:125330065-125330087 CAGTGCAGGGGTGCGCTGTGGGG + Intronic
1096898477 12:54849904-54849926 GGGTGTAGGGGAGCCCCGTGGGG - Intronic
1097065867 12:56320069-56320091 TAGGGGAGAGAAGCCCAGTGTGG + Intronic
1098977628 12:76919829-76919851 TGGTGGTGGTGAGCCCTTTGTGG + Intergenic
1103189421 12:118988389-118988411 TAGTGGAGGGGAGCCGTGGAAGG + Intronic
1104702929 12:130920908-130920930 TAGTGGAGGGGAGATCGGGGTGG + Intergenic
1104730212 12:131101216-131101238 TTGTGGGGTGGAGACCTGTGTGG + Intronic
1105343353 13:19549076-19549098 TTGTGGAGGGGAGCACAGTGGGG - Intergenic
1105536958 13:21275019-21275041 TTGTGGAGGGGAGTGCAGTGGGG + Intergenic
1106902879 13:34372931-34372953 TTATGGAGGGGAGCCCTGGTAGG - Intergenic
1108583592 13:51848362-51848384 TAGTGGAGTGGTGCCATATGTGG - Intergenic
1112569804 13:100583683-100583705 TAGTGGTGGGGAGCCAGGTACGG - Intronic
1113269681 13:108659944-108659966 TATTGTAGGAGAGCCGTGTGTGG + Intronic
1113417158 13:110137254-110137276 TACGGCAGGGGAGTCCTGTGAGG - Intergenic
1113660728 13:112104988-112105010 CAGCGGAGGGGAGCGCTGGGGGG + Intergenic
1113669946 13:112169881-112169903 GAGTGGAGGCCAGCCCTGAGAGG - Intergenic
1113853297 13:113430140-113430162 TGGTGGATGGGAGCCTAGTGGGG - Intronic
1114389813 14:22294969-22294991 TACTGTAGAGGAGGCCTGTGTGG - Intergenic
1114529095 14:23384355-23384377 GAGGTGAGAGGAGCCCTGTGAGG + Intronic
1117203373 14:53414977-53414999 TAGGGGAGGGGAAGCCTGTAAGG + Intergenic
1118468004 14:66048728-66048750 AAGTGGAGAGGAGCATTGTGTGG - Intergenic
1118716652 14:68564644-68564666 TGGTGGTGGGGAGCCCTGTGAGG - Intronic
1119660986 14:76451582-76451604 TAGGGGCTGGGAGCCCAGTGAGG + Intronic
1121053790 14:90836822-90836844 GGGTGGAGGGGTGCCCTGTGAGG + Intergenic
1121053806 14:90836867-90836889 GGGTGGAGGGGTGCCCTGTGAGG + Intergenic
1121465781 14:94114796-94114818 AAGTGGAGGGGAAGCCAGTGTGG + Intronic
1121872839 14:97425434-97425456 GAGTGCAAGGGAGCCCTGTCGGG - Intergenic
1123921339 15:25071907-25071929 CAGTGCAGGGAAGCCCTGTGAGG + Intergenic
1124267544 15:28250307-28250329 TGGTGGTGGTGAGCCCAGTGAGG - Intronic
1126506164 15:49406636-49406658 TAGTGGTGGGGAGTGCCGTGGGG + Intronic
1126626513 15:50690584-50690606 TAGTAGAGGGTAGCCGGGTGTGG + Intergenic
1128232891 15:66047898-66047920 GGGTGGAGGGGAGGCCTGAGGGG + Intronic
1128719096 15:69932918-69932940 TAGTGCTAGGGAGCCCTGGGTGG - Intergenic
1129503516 15:76061456-76061478 TGGAGGTGGGGAGCCCTGAGGGG + Intronic
1130357152 15:83144073-83144095 TAGTGGTGGGCAGCCTTGTCTGG - Intronic
1130372673 15:83299339-83299361 AAGTAGAGGGAAGCCCTGAGGGG - Intergenic
1132349845 15:101132920-101132942 GTGTGGAGTGGAGGCCTGTGGGG - Intergenic
1132631039 16:917635-917657 TAGGGGAGGGCAGCCCTGCCTGG - Intronic
1132668107 16:1091041-1091063 TACTGGTGGGGGCCCCTGTGGGG + Intronic
1132837238 16:1960075-1960097 CAGTGGAGGGGTGCCCGGGGCGG - Intronic
1132929336 16:2450992-2451014 AGGTGGAGGGAAGCCCAGTGGGG - Intronic
1135113457 16:19708031-19708053 CAGGGGAGGTGCGCCCTGTGGGG - Intronic
1136986109 16:35106644-35106666 TAATGGGGGTGTGCCCTGTGGGG + Intergenic
1137365510 16:47856095-47856117 TGGTAGAGTGGAGCACTGTGGGG - Intergenic
1139298335 16:65922353-65922375 TTGTGGAGGGGAACCCAGAGTGG - Intergenic
1139371735 16:66473324-66473346 TGGTGGTGGTGACCCCTGTGGGG + Intronic
1140376365 16:74448309-74448331 TAGTGGAGAGGAGGCGAGTGGGG + Intergenic
1140818475 16:78641761-78641783 GAGTGGAGGGGAGCTCTGTCAGG - Intronic
1141626035 16:85261575-85261597 GAGTGGAGGGCTGCCCCGTGTGG + Intergenic
1142290463 16:89191813-89191835 AAGTGGAAGGGGGCCCCGTGGGG - Exonic
1142377379 16:89712828-89712850 AAGAGGAGGGGAGCCATCTGGGG + Intronic
1203145206 16_KI270728v1_random:1794460-1794482 TCGTGGACGGCAGCGCTGTGGGG - Intergenic
1142943379 17:3402621-3402643 AAATGGAGAGTAGCCCTGTGTGG + Intergenic
1143327464 17:6108876-6108898 AAATGGAGGGGGGCCCTGTCAGG - Intronic
1145707758 17:26938110-26938132 GAGTGGAGTGGAGTGCTGTGGGG + Intergenic
1145718848 17:27049565-27049587 TAGTGGAGGTGAGGCCTCTACGG - Intergenic
1145999220 17:29121447-29121469 GAGTGGACAGGAGCCCAGTGGGG + Intronic
1147374512 17:40015868-40015890 CTGTGGAGGGAAGCCCGGTGGGG + Intronic
1147669693 17:42169856-42169878 TAATGGTGGGGAGGCCTGAGAGG - Intronic
1148106503 17:45121509-45121531 GGGAGGAGGGGAGTCCTGTGAGG - Intronic
1148205327 17:45776108-45776130 TGGTGAAGGGGAGCCCAGGGAGG - Intergenic
1149627642 17:58090958-58090980 CAGGGGAGGGGAGACCTGGGTGG + Exonic
1150346223 17:64406587-64406609 CAGGGGAGGGGAGCTCTTTGCGG - Intronic
1203212777 17_KI270730v1_random:95649-95671 GAGTGGAGTGGAGTGCTGTGGGG + Intergenic
1153988824 18:10376945-10376967 TAGTGGAGTGGAGAGCTGTCAGG - Intergenic
1155249636 18:23942354-23942376 TGGTGCAGGGGTGCCCTGAGAGG - Intronic
1157546556 18:48550572-48550594 GAGTGGAGAGGAGCCCAGAGGGG - Intronic
1157580135 18:48769289-48769311 TAGTGGAGGGGAGCTCGATGTGG - Intronic
1157719150 18:49910217-49910239 AACTGGAGGAGAGCCCAGTGTGG + Intronic
1158488774 18:57891516-57891538 TAGTGGGGAGGAGGCCTTTGGGG + Intergenic
1160096180 18:75875731-75875753 CAGTGGAGAGGAGCCCCGTGTGG + Intergenic
1160562961 18:79771018-79771040 GTGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160562973 18:79771052-79771074 GCGTGGAGGGGAGCCCTGTGTGG - Intergenic
1160563137 18:79771511-79771533 GCGTGGAGGGGAGCCCTGTGTGG - Intergenic
1161315283 19:3614699-3614721 GACTGGATGGGACCCCTGTGGGG - Intronic
1161576700 19:5058414-5058436 GGGAGGAGGGGAGCCCGGTGAGG + Intronic
1161605000 19:5209958-5209980 TAGTGGAAGGTGGCCCTGTTGGG - Intronic
1161878172 19:6928044-6928066 TAGTGGAGGAGAACACTGGGAGG - Intronic
1162777447 19:12988245-12988267 TTGTGGAGGGGAGCAGAGTGAGG + Intergenic
1163326060 19:16603922-16603944 TAATGGAGGGGAGTCTTCTGTGG - Intronic
1164462372 19:28459976-28459998 TGGTGGCTGGGAGCCCAGTGAGG + Intergenic
1164523336 19:28995492-28995514 TGGTGGAGGGCAGCCCTCAGGGG + Intergenic
1164761284 19:30730186-30730208 TAGAGGAGGAGAGCCCACTGGGG - Intergenic
1165867901 19:38950143-38950165 TAGTGGACGGGCCCACTGTGTGG - Exonic
1166048953 19:40246854-40246876 TGGTGGAGGGGAGAGCTGGGAGG - Intronic
1167959850 19:53096934-53096956 GAGCGGAGGGGCACCCTGTGGGG + Intronic
1167963649 19:53126775-53126797 GAGCGGAGGGGCACCCTGTGGGG + Intronic
925362279 2:3288009-3288031 GAGGAGAGGGGAACCCTGTGAGG - Intronic
926036146 2:9637570-9637592 GAGTGAAAGGGACCCCTGTGGGG + Intergenic
926772850 2:16393562-16393584 TAGGGGACTGGAGCCCTGTAGGG + Intergenic
927210223 2:20634585-20634607 CCGTGGAGGGGAGCTCTGTGGGG - Intronic
927703454 2:25282565-25282587 CAGAGGAGGGGAGCCCTGCTGGG - Exonic
929961246 2:46497891-46497913 GAGTGGAGGGGAGCATTGTGGGG - Intronic
930013756 2:46957021-46957043 CAGTGGAGGGGAGCCCAGGCTGG - Intronic
930108390 2:47657743-47657765 TACTGGAGCTGAGCCCAGTGGGG + Intergenic
933771599 2:85748127-85748149 GAATGGCAGGGAGCCCTGTGTGG + Intergenic
937247970 2:120505759-120505781 TAGTGATGGGGAGCCATGAGGGG + Intergenic
937833179 2:126445433-126445455 GAGAGGAGGGGAGCACTGTGTGG - Intergenic
938402565 2:131005370-131005392 TGCTGGAGGGCAGCCCTGTGTGG - Intronic
938795791 2:134718003-134718025 CAGTGGAGGGGAGCTCTGAAGGG + Intronic
942034768 2:172000016-172000038 GCGTGGAGGAGAGCCCCGTGAGG + Intronic
942160990 2:173187015-173187037 TAGTGGTGGGGAGAACTGGGAGG - Intronic
946026172 2:216673217-216673239 TAGGGGAGGCCAGCCCTGTGGGG + Exonic
946434887 2:219644840-219644862 TAGTGGAGGGGAGCCCCAGCCGG + Intergenic
946842496 2:223832461-223832483 CAGTGGAGGAGAGCCCTCTTGGG + Intronic
947218196 2:227768200-227768222 TGGGGGAGGGGAACCCTGGGAGG - Intergenic
947494687 2:230626269-230626291 CAGTGGAGGGGAGTTCTGTCGGG - Intergenic
947592775 2:231395052-231395074 TGGTGGTGGGGAGCCCTCAGAGG + Intergenic
947822399 2:233081227-233081249 CAGCGGAGGGGAGCCCTGTCTGG + Intronic
1169905907 20:10603767-10603789 TAGTGGGCTGGAGGCCTGTGAGG - Intronic
1171323057 20:24263877-24263899 TGGTGGATTGGAACCCTGTGAGG + Intergenic
1171459870 20:25292369-25292391 CCGTGGAGGGGATCACTGTGAGG - Intronic
1172025084 20:31943059-31943081 GAGTGGGGGGGAGGCCTGGGTGG - Exonic
1173092717 20:39989173-39989195 TAGTGAAGAGGAGCCAAGTGTGG + Intergenic
1173617716 20:44413822-44413844 TAGTGTGGGGGATCCCTGGGTGG - Intronic
1174398150 20:50260696-50260718 ATGGGGTGGGGAGCCCTGTGGGG - Intergenic
1174789600 20:53465050-53465072 AAGGGCAGGGGAGCCCAGTGAGG + Intronic
1175238000 20:57526371-57526393 GAGGGGAGGAGAGCCCTGTAGGG + Intergenic
1176100429 20:63361982-63362004 TGGAGGAGGGGCGCCTTGTGCGG + Intronic
1177433454 21:21020353-21020375 GAGTGGAGGACAGCCCTGAGAGG - Intronic
1178411272 21:32365662-32365684 GAGTAGAGAGGAGGCCTGTGTGG - Intronic
1179280221 21:39927650-39927672 CAGAGGAGGCCAGCCCTGTGAGG - Intronic
1180002795 21:45002690-45002712 CACTGGAGTAGAGCCCTGTGAGG + Intergenic
1181397755 22:22633835-22633857 TAGGGATGGGGAGCCCTCTGGGG - Intergenic
1181466440 22:23113055-23113077 GCCTGGAGGTGAGCCCTGTGAGG - Intronic
1181509491 22:23382641-23382663 TAGTGGGGGGGACACCTGTCTGG - Intergenic
1181651656 22:24262223-24262245 TAGGGATGGGGAGCCCTCTGGGG + Intergenic
1181705723 22:24648516-24648538 TAGGGATGGGGAGCCCTCTGGGG - Intergenic
1184648290 22:45907966-45907988 CAGGGGAGGGGAGCTCTGGGAGG - Intergenic
1203291459 22_KI270735v1_random:42650-42672 GAGTGGAGTGGAGTACTGTGGGG - Intergenic
1203299441 22_KI270736v1_random:66806-66828 TAGTGGAGAGGAGTCGAGTGGGG + Intergenic
949284694 3:2388408-2388430 TAGAGGAAGGGAGGCCAGTGTGG - Intronic
950416869 3:12873814-12873836 TACTGGATGCGAGACCTGTGTGG - Intergenic
953414865 3:42709784-42709806 TAGAGGTGGGCAGACCTGTGGGG + Exonic
953648005 3:44773340-44773362 TAGGGGAGGGGAGGACTCTGTGG + Intronic
954301582 3:49703350-49703372 GATTGGAGGGGAGGGCTGTGGGG + Intronic
955563392 3:60217699-60217721 TAATGGAGGGAAGGCCAGTGTGG - Intronic
961543903 3:127618823-127618845 TTGTGGAGATGAGCCCTGTGGGG + Intronic
961780430 3:129317360-129317382 TAGGAGAGGGGATCCCTTTGGGG + Intergenic
963055087 3:141179670-141179692 TGGTGGAGGTGAGCCTGGTGTGG - Intergenic
967892775 3:194374972-194374994 GGGTGGAGGAGAGCCCAGTGTGG - Intergenic
968150547 3:196334780-196334802 AAGGGGAGGGGTGCCCTGGGAGG + Intronic
968150778 3:196335410-196335432 GAGGGGAGGGGTGCCCTGGGAGG + Intronic
968150793 3:196335445-196335467 GAGGGGAGGGGTGCCCTGGGAGG + Intronic
968150810 3:196335480-196335502 GAGGGGAGGGGTGCCCTGGGAGG + Intronic
968603847 4:1522336-1522358 GAGTGGAGGGGAACCCAGGGTGG - Intergenic
969124359 4:4935466-4935488 TAATGGAGGTAAGGCCTGTGAGG - Intergenic
969148063 4:5141620-5141642 CAGCAGCGGGGAGCCCTGTGGGG + Intronic
969314372 4:6372650-6372672 TGGTGGAGGTGAGCCCTCGGAGG - Exonic
974119242 4:57618952-57618974 CGGTGGAGGTGAGGCCTGTGAGG + Intergenic
978563964 4:110062418-110062440 TACTGCTGGGGAGCACTGTGGGG + Intronic
981371181 4:143960677-143960699 TAGTGGCGGGAGGCACTGTGCGG + Intergenic
982116453 4:152102539-152102561 TAGTGGCTGGGAGCTCTGTGAGG - Intergenic
983701820 4:170605957-170605979 TAGTGCATGTGAGCCCTGAGAGG + Intergenic
984694986 4:182770375-182770397 TACTGGAAGGGAGCCTTGGGTGG - Intronic
984809272 4:183779900-183779922 TAATGGAGTGGAGCCAAGTGGGG - Intergenic
985223169 4:187730051-187730073 TACTGGAGGTGAGCCCTCAGTGG - Intergenic
986239691 5:5949560-5949582 AAGTGAAGGGAAGCCCAGTGAGG - Intergenic
986735770 5:10666231-10666253 GAGAGGAGGGGACCCCTCTGGGG + Intergenic
988657396 5:33227302-33227324 TAGTGGAAGGCAGAACTGTGGGG - Intergenic
991504031 5:67305780-67305802 GTGTGGAGGGGACCCCTCTGGGG - Intergenic
991510013 5:67365833-67365855 TGGTGGAGGGGACCCCACTGGGG - Intergenic
993734189 5:91456709-91456731 GAGTGGAGGGGGGCGGTGTGGGG + Intergenic
994992306 5:107012575-107012597 TAGTGGAGGAGAGCCCAGCCTGG - Intergenic
997642787 5:135460428-135460450 TGGTGGGGGTGAGCCATGTGAGG - Intergenic
1000889035 5:166782360-166782382 TGGTGGGGGGGAGTCCTGGGGGG - Intergenic
1001824875 5:174736407-174736429 GAGTGGAGGGCAGCCCGGGGTGG - Intergenic
1003425608 6:5996432-5996454 TAGGGGAGGGGCGTCCTCTGTGG + Intergenic
1005381119 6:25235298-25235320 AAGTGCTGGGGAGCCATGTGTGG - Intergenic
1006377669 6:33680501-33680523 GAGTGGAGGGGCCCCATGTGAGG + Intronic
1006572564 6:35017753-35017775 TGGTGGTGGGCAGGCCTGTGAGG - Exonic
1006638771 6:35478207-35478229 AATGGGAGGGAAGCCCTGTGCGG + Intronic
1007396098 6:41578688-41578710 TGGGGGAGGGGAGATCTGTGGGG + Intronic
1007636692 6:43303957-43303979 CCCTGGAGGGAAGCCCTGTGGGG + Intronic
1008493789 6:52112491-52112513 GAATGGAAGGGAGGCCTGTGTGG + Intergenic
1009993770 6:70876965-70876987 TAGAGGAAGGGAGACCTGTGAGG + Intronic
1012369016 6:98480275-98480297 TAGAGGAGGGCAGCCCTGACAGG + Intergenic
1013922145 6:115419020-115419042 TTGTGGAGGGGAGCAGTATGGGG + Intergenic
1014038099 6:116791331-116791353 TACTGGAGAGGAGCCCTCTTCGG - Intergenic
1014928009 6:127297844-127297866 TAGTGGAGAGGGGGCCTGAGTGG - Intronic
1015713489 6:136166695-136166717 TAGTGGAGGTGAGGCCTGGTGGG - Intronic
1015885091 6:137909726-137909748 TGGCAGAGAGGAGCCCTGTGAGG + Intergenic
1016348395 6:143140923-143140945 TAGAGCAGGGGAGGCCTCTGGGG - Intronic
1018369309 6:163153286-163153308 CAATGGAGTGGTGCCCTGTGAGG + Intronic
1019326202 7:439517-439539 TCGTGGAGGGCAGGGCTGTGGGG - Intergenic
1019768016 7:2865577-2865599 CGGAGGACGGGAGCCCTGTGAGG - Intergenic
1022957704 7:35396637-35396659 GAGTGGAGGGCAGACTTGTGGGG - Intergenic
1027232698 7:76281843-76281865 TAGTGGAGGGGAGCCCTGTGCGG - Intronic
1029235429 7:99112400-99112422 TAGTGGAAGAGAGGCCTCTGTGG + Intronic
1031961156 7:127991236-127991258 CAGTGGAGGGGAGCAATTTGGGG - Intronic
1032012655 7:128356967-128356989 GAGTGGAGGGGAACCCTCTGTGG + Intronic
1032504254 7:132423973-132423995 GAGGGGAGGGCAGCCCTGAGAGG - Intronic
1033542577 7:142370956-142370978 TTGTGGACGGGAACCCAGTGTGG + Intergenic
1033661578 7:143406613-143406635 TAGAGGAGGGCAGTCTTGTGGGG + Intronic
1033821096 7:145134736-145134758 TGGTGTATGGGAGCCCAGTGAGG - Intergenic
1034421847 7:150994835-150994857 GAGTGGAGGGAAGCCCTGCAGGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036155160 8:6334902-6334924 TAGGGGCGGGGTGTCCTGTGTGG + Intergenic
1036616295 8:10390252-10390274 GAGAGGAGGGGGTCCCTGTGTGG + Intronic
1038753828 8:30321783-30321805 TAGGTGAGTGGACCCCTGTGTGG - Intergenic
1039467918 8:37797137-37797159 GCGTGGAGGGGGGCCCTGGGCGG - Intronic
1039880597 8:41623133-41623155 CTGTGGAGGGAAGTCCTGTGCGG + Exonic
1042220391 8:66467506-66467528 TAGTGGAAGGGAAACTTGTGAGG - Intronic
1049284488 8:141767190-141767212 TGGTGGAGGGCAGGCTTGTGTGG + Intergenic
1049284916 8:141769395-141769417 TGGTGGGGGGGAGGCCTGTGTGG - Intergenic
1049535958 8:143182253-143182275 CACAGGAAGGGAGCCCTGTGTGG - Intergenic
1053241662 9:36500562-36500584 TAGTAGAGGGGAGCCATGAAGGG + Intergenic
1054854057 9:69879066-69879088 TACTGGAGGTGAGGCCTGGGGGG - Intronic
1055829524 9:80361121-80361143 TAGAGGACTGGAGCCCTGTGTGG - Intergenic
1057172803 9:92973936-92973958 CAGGGAAGGGAAGCCCTGTGGGG - Intronic
1057401511 9:94727102-94727124 GACTGGAGATGAGCCCTGTGGGG - Intronic
1057422889 9:94926622-94926644 GAGTGGGGGAGTGCCCTGTGGGG + Intronic
1057788964 9:98110044-98110066 AAGAGGAGGTGACCCCTGTGGGG - Intronic
1057799886 9:98184558-98184580 TAGAGGACGGGAGCACTGTGGGG - Intronic
1060438335 9:123615589-123615611 TAGTGAAGCTGAGGCCTGTGGGG - Intronic
1060552355 9:124491575-124491597 TTGGGGAGGGCAGGCCTGTGTGG + Intronic
1060848274 9:126854523-126854545 GAATGGAGAGGAGCCCTTTGGGG - Intergenic
1062002032 9:134221067-134221089 TAGTGGGGTGGAGTTCTGTGGGG - Intergenic
1062424508 9:136499841-136499863 GCGTGGAAGGGAGCCCCGTGCGG - Intronic
1186511754 X:10134963-10134985 GAGTGGCTTGGAGCCCTGTGGGG + Intronic
1190064106 X:47228817-47228839 TAGTTGGGGGCTGCCCTGTGAGG - Exonic
1192564579 X:72153119-72153141 AAATGGAAGGGAGCCCTCTGTGG + Intergenic
1195240797 X:102949903-102949925 TTGTGGAGTGGGGACCTGTGGGG - Intergenic
1198436716 X:136624336-136624358 TAGTGGAGGTGAGACGGGTGAGG - Intergenic
1202588815 Y:26460755-26460777 TTGTGGAGGGGAGTGCAGTGGGG + Intergenic