ID: 1027232990

View in Genome Browser
Species Human (GRCh38)
Location 7:76282764-76282786
Sequence GCGGCTGGAGCTCCAGGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 657
Summary {0: 1, 1: 0, 2: 5, 3: 73, 4: 578}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027232990_1027232999 16 Left 1027232990 7:76282764-76282786 CCCGCTCCTGGAGCTCCAGCCGC 0: 1
1: 0
2: 5
3: 73
4: 578
Right 1027232999 7:76282803-76282825 GCTCGCGCTCTGCGGAGAAGCGG 0: 1
1: 0
2: 0
3: 3
4: 60
1027232990_1027232998 8 Left 1027232990 7:76282764-76282786 CCCGCTCCTGGAGCTCCAGCCGC 0: 1
1: 0
2: 5
3: 73
4: 578
Right 1027232998 7:76282795-76282817 CAAATCTCGCTCGCGCTCTGCGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027232990 Original CRISPR GCGGCTGGAGCTCCAGGAGC GGG (reversed) Exonic
900581821 1:3413260-3413282 GCCGCTGTGGCTCCAGGGGCAGG - Intronic
900965213 1:5952714-5952736 GCTGCTGGAGCTCCACGTCCAGG - Exonic
900978080 1:6029603-6029625 GCAGCGGGGGCTGCAGGAGCTGG - Intronic
901038138 1:6348678-6348700 GAGGCTGGAAGTCCAGGATCAGG - Intronic
901089994 1:6634747-6634769 GACGCTGGACCTGCAGGAGCGGG + Exonic
901631579 1:10650826-10650848 TCGGCTGGAGCCCCAGGGTCGGG - Intronic
901646006 1:10717068-10717090 GCTGCTGGAGGGACAGGAGCAGG + Intronic
901652617 1:10751904-10751926 GAGGCTGGACCTCCACCAGCTGG + Intronic
901717719 1:11170047-11170069 GCGGCTGGTGCTTCTTGAGCTGG + Intronic
902226002 1:14996798-14996820 GGCCCTGGAGCACCAGGAGCGGG - Intronic
902504369 1:16929860-16929882 GCGGCTGGAGCCTGGGGAGCTGG + Exonic
902511954 1:16971530-16971552 GCAGCTGGAGCTGCAGCAGGAGG + Exonic
902536231 1:17120517-17120539 GAAGATGGAGCTCCAGGAACGGG + Intergenic
902564890 1:17304973-17304995 GCAGCTGGAGCTGCAGGCACAGG + Intergenic
902639723 1:17759335-17759357 GCGGCACGTGCTGCAGGAGCAGG - Intronic
902764728 1:18606757-18606779 GCAGCTGGAGTTCCGGGAGTTGG - Intergenic
902810644 1:18886053-18886075 GTGGCTGGGGGTCCAGGAACTGG - Intronic
903331964 1:22601105-22601127 GCAGCTGGGCCTCAAGGAGCTGG - Intronic
903669177 1:25025401-25025423 TCGGCTGGAGCTCTAGCTGCCGG + Intergenic
903703409 1:25267521-25267543 GCGGGTTCAGCTCCAGGAGGCGG - Intronic
903712676 1:25337850-25337872 GCGGGTTCAGCTCCAGGAGGCGG - Intronic
904625145 1:31798236-31798258 GCAGCTGGCCCCCCAGGAGCTGG - Exonic
905108136 1:35576194-35576216 GGGGCTGGACTTCCAGGAGCTGG + Intronic
905183108 1:36178546-36178568 GCAGCGGGAGCGCGAGGAGCAGG + Exonic
905544404 1:38786293-38786315 GTGGCTCCAGCTCCAGGAGAGGG + Intergenic
905872696 1:41414310-41414332 AGGGCTGCAGCCCCAGGAGCAGG + Intergenic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906325548 1:44843266-44843288 GCGGCTGGAGCTCCAGAAAAGGG + Intergenic
906407045 1:45550497-45550519 GCGTCTGCAGATCCAGGCGCTGG - Intergenic
906724657 1:48035517-48035539 GCAGCTGGAGGTCAAGCAGCTGG - Intergenic
907401860 1:54229294-54229316 GAGGCTGGAGGTGGAGGAGCTGG + Intronic
907489686 1:54800983-54801005 GCGGCAGGAGCTCCAGCTGGCGG - Exonic
907492502 1:54817129-54817151 GCAGCTGGAGCTGCAGGCGAAGG + Intronic
907666780 1:56439855-56439877 ACAGCTGATGCTCCAGGAGCAGG + Intergenic
908308825 1:62854873-62854895 TCTGCTCTAGCTCCAGGAGCAGG + Intronic
908574948 1:65449575-65449597 GCTGCTGCAGCTGAAGGAGCTGG + Intronic
908825964 1:68132898-68132920 GCTGCTGGAGCCCCGGGAGGTGG + Intronic
908932308 1:69331713-69331735 GCGGCTGGAGCTGGAGCAGCTGG + Intergenic
910450075 1:87335300-87335322 GCGGGTGGGGCTCCAGGTCCGGG + Intronic
911612361 1:99970587-99970609 GCTTCTTGAGCTCCAGGTGCTGG - Exonic
911644058 1:100320164-100320186 GCAGCTGGAGCTGAAGCAGCTGG - Intergenic
912162822 1:107007033-107007055 GCAGTGGGAGATCCAGGAGCTGG - Intergenic
912401572 1:109397808-109397830 GCGGCAGCAGCTGCAGGAGGAGG + Exonic
912420498 1:109539379-109539401 GCGGCTGAGGCTCCAGGGGATGG - Intergenic
912450666 1:109765660-109765682 TCGGCTGAGGCACCAGGAGCTGG + Intronic
912993375 1:114510718-114510740 GAGGCTGGCGGTCCAGGAGGCGG + Exonic
913160406 1:116139999-116140021 GAGGCTGGTGGTCCAAGAGCAGG - Intergenic
913269107 1:117075551-117075573 GCCGCTGGTCCTCCAGGAGCAGG - Exonic
914790856 1:150876437-150876459 GCAGCTGGAGCTGAAGGCGCCGG - Intronic
914950739 1:152111224-152111246 GCGGCTGAAGCGCGAGGAGGAGG - Exonic
914950755 1:152111341-152111363 GCGGCTGAAGCGCGAGGAGCCGG - Exonic
914950788 1:152111644-152111666 GCGGCTGAAGCGCCAGGAGGAGG - Exonic
915127999 1:153679153-153679175 GCGGCGGCAGCAGCAGGAGCAGG - Exonic
915222437 1:154385691-154385713 GTGGGTGGAGCTCCAGGAAGAGG + Intergenic
915536710 1:156540806-156540828 GCTGCTGAAGCTCCAGGAAGAGG - Exonic
916144488 1:161726971-161726993 GTGGCTGCAGCTCCCGGGGCCGG + Exonic
917683956 1:177396854-177396876 GTGTCTGGAGCTCAAGGAGGAGG + Intergenic
917979617 1:180260770-180260792 TAGGCTGGAGCTCGAGGAGAGGG - Intronic
918121584 1:181545594-181545616 GGGGCAGGAGCTCAAGAAGCTGG + Intronic
919092836 1:192994709-192994731 GGGGCTGGAGCAGCCGGAGCAGG + Intergenic
919805742 1:201380109-201380131 GAGGCTGCAGCTGCAGGAACAGG + Intronic
920177285 1:204110058-204110080 GCGGGTGGAGCACCTGAAGCCGG - Intronic
920250259 1:204618390-204618412 GGGGCTGGAGCTCCGGGTGCAGG - Exonic
920446756 1:206023749-206023771 GCTGCTGGTGCTCCTGGAGCTGG - Exonic
921487125 1:215728169-215728191 GTGGCTTGAGCCCAAGGAGCTGG + Exonic
922561179 1:226570667-226570689 GATGCTGCAGCTCCAGGTGCTGG - Intronic
922925217 1:229342474-229342496 GCGGCTGGCGCTCGAGGCGGCGG - Exonic
924482110 1:244445141-244445163 GCTGCTGAAATTCCAGGAGCAGG + Intronic
924551350 1:245080909-245080931 GAGGCTGGAGTACAAGGAGCAGG - Intronic
924694046 1:246381853-246381875 GGGTCTGGGGCTACAGGAGCTGG - Intronic
924694109 1:246382078-246382100 GGGTCTGGGGCTACAGGAGCTGG - Intronic
1062906730 10:1184628-1184650 CAGGCTGGAGCTGCAGAAGCAGG - Intronic
1063201062 10:3785599-3785621 GCGGCCGGAGCTAAGGGAGCCGG + Intergenic
1063444111 10:6097826-6097848 CAGGCTGGAGCCCCAGGAGTGGG + Intronic
1065540703 10:26763921-26763943 GCTGGTGGAGCTCCAGAAGGAGG + Exonic
1065917319 10:30364738-30364760 GGGGCTGGGGCCCCTGGAGCAGG + Intronic
1065917336 10:30364835-30364857 ACTGCTGGAGCTGCAGGAGCTGG - Intronic
1067045788 10:42984543-42984565 GCGGGTGCAGCACCACGAGCAGG - Intergenic
1067233454 10:44427535-44427557 GCAGCAGGAGGTCCAGGACCTGG - Intergenic
1067576408 10:47411322-47411344 GGGGATGGATCACCAGGAGCAGG + Intergenic
1067849924 10:49748106-49748128 GCGGCTGGAGCTACGGGGGTGGG - Intronic
1068305234 10:55199761-55199783 ACGGCTGGAGCTAGAGCAGCTGG - Intronic
1070288349 10:75099536-75099558 GCGGCTAGAATTCCAGGTGCTGG + Intronic
1070302065 10:75210845-75210867 CGGGCTGCAGCTCCAGCAGCTGG - Exonic
1071509659 10:86253589-86253611 GCGGGTGGAGCTTCAGGGCCTGG - Intronic
1071695406 10:87863989-87864011 GCGGCTGCAGCTCCAGGGAGGGG + Exonic
1072021860 10:91410406-91410428 GCGGCGGGAGCGCCAGGCGGCGG - Exonic
1075995645 10:126874097-126874119 GAGTCTGGAGTTCCAGGAGGAGG - Intergenic
1076839696 10:133039963-133039985 GGGGCTGGAGCTGGAGGAGCCGG + Intergenic
1078050301 11:7960099-7960121 GCTGCTGGAGGTAAAGGAGCAGG - Exonic
1078057131 11:8018176-8018198 GAGGCTGGAGCGCGAGGAGGGGG - Intergenic
1078142999 11:8705145-8705167 GAGGTTTGAGCTGCAGGAGCAGG - Intronic
1078144308 11:8712640-8712662 GCTGCTGGAGTGGCAGGAGCGGG - Exonic
1078388902 11:10917910-10917932 GAGGCTGGAGCTGGAGCAGCTGG + Intergenic
1078740488 11:14061744-14061766 GCAGCTGCAGCTCCAAAAGCTGG + Intronic
1080109961 11:28555537-28555559 GTGGCTGGAGCTCCAGCTGGAGG + Intergenic
1083238658 11:61369394-61369416 ACATCTGGAGCTCCAGGAGTGGG - Exonic
1084151661 11:67290362-67290384 GCAGCTGGTGCTCCAGTATCGGG + Exonic
1084557359 11:69883041-69883063 GCAGCTGGAGCCCCAGAAGCTGG - Intergenic
1084561588 11:69908661-69908683 ACGTCTGTAGCCCCAGGAGCTGG + Intergenic
1084573600 11:69975022-69975044 GGGGCTGGAGCTGGAGGGGCTGG + Intergenic
1084599197 11:70134863-70134885 GTGGCAGGAGCTCCAGGTGCAGG + Intronic
1085000313 11:73027810-73027832 ACGGCTGGAGCTGGAGCAGCTGG - Intronic
1085011081 11:73142158-73142180 GGGGCGGGGGCCCCAGGAGCAGG + Exonic
1086304014 11:85460228-85460250 GTGACTGGAGCTCCAGCAGTAGG - Intronic
1088323915 11:108582702-108582724 GAGGCTGGAGGTCAAGGTGCTGG + Intronic
1090478814 11:127049637-127049659 GCGTCAGCAGCTCCAGGGGCTGG + Intergenic
1093939027 12:25032623-25032645 GAGGCTGGAACTCCAAGATCAGG + Intronic
1094036995 12:26082157-26082179 GCAGCTGGAGCTGCAGTGGCTGG + Intergenic
1094063519 12:26340166-26340188 GCTGGCGGAGCTCAAGGAGCAGG - Exonic
1095485494 12:42680157-42680179 GTGGGTGGAGCTCGAGTAGCAGG + Intergenic
1095731579 12:45511695-45511717 ACGGCTGGAGCTGGAGCAGCTGG + Intergenic
1096524495 12:52202517-52202539 GAGGCTGGAGTTGGAGGAGCGGG - Intergenic
1096714628 12:53483617-53483639 GCAGCTGGAACTCAAGGAGAGGG - Exonic
1096944224 12:55386305-55386327 GCAGCTGGAGATCCAGGAAAGGG - Intergenic
1097185412 12:57193941-57193963 GCGGCTGGAGTTCCCGATGCAGG - Exonic
1097191055 12:57219852-57219874 GGAGCTGGAGACCCAGGAGCGGG + Intronic
1097249685 12:57625693-57625715 GGGGCAGTAGCACCAGGAGCGGG + Exonic
1097486708 12:60212595-60212617 ACGGCTGGAGCTGGAGCAGCTGG - Intergenic
1097558185 12:61166579-61166601 GTGGCTGGAGCTGAAGCAGCTGG + Intergenic
1099487741 12:83249280-83249302 GCAGCTAGAGCTGCAGCAGCTGG - Intergenic
1101095103 12:101330333-101330355 GTGGCTAGAGCACCAGGAGCAGG + Intronic
1102687183 12:114734280-114734302 GGGCCTGGTGCTCCAGGAGGAGG - Intergenic
1103009640 12:117448316-117448338 GTGGCTGGAGCTCCAGGTAAGGG - Intronic
1103503444 12:121423393-121423415 GCGGCTGCAGCTGCAGGATGAGG + Exonic
1103637819 12:122322653-122322675 GAGGATGGTGCTCCTGGAGCAGG - Intronic
1104115492 12:125745487-125745509 GAGGGTGGAGCTCCTGGAGGAGG - Intergenic
1104793467 12:131499109-131499131 GAGGCAGCAGCTCCAGAAGCAGG + Intergenic
1104802925 12:131566906-131566928 GCGGCTGCAGCACACGGAGCCGG + Intergenic
1104877269 12:132044251-132044273 GCGGCTGGAGCAGGAGGAGGCGG + Exonic
1104924699 12:132308158-132308180 GCGCCTGGAGCCCCAGGAGCTGG + Intronic
1105407029 13:20141848-20141870 GCGACTGGAGTCCCAGGAGGTGG - Exonic
1105449737 13:20488779-20488801 GGCACAGGAGCTCCAGGAGCGGG + Intronic
1105523474 13:21152716-21152738 GTGGCTGGAGCACAAGGGGCAGG + Intergenic
1106406617 13:29480244-29480266 GCAGGCCGAGCTCCAGGAGCTGG + Exonic
1106662464 13:31814406-31814428 GGGCTTGGAGCTGCAGGAGCTGG - Intergenic
1108063558 13:46554643-46554665 GTAGTTGGAGTTCCAGGAGCGGG + Intronic
1108930135 13:55807487-55807509 ACGGCTGGAGCTGGAGCAGCTGG + Intergenic
1110022289 13:70490582-70490604 ACAGCTGGAGCTGGAGGAGCTGG - Intergenic
1110646142 13:77886852-77886874 GAATCTGGAGCTCCAGGAGAGGG + Intergenic
1112388352 13:98960738-98960760 AAGTCAGGAGCTCCAGGAGCAGG + Intronic
1113066430 13:106377546-106377568 GAGGCTGGAAGTCCAGGATCAGG - Intergenic
1113382641 13:109817778-109817800 TCGGCTGGAGCTCCGAAAGCTGG + Intergenic
1113653955 13:112056845-112056867 GGGGCTGGCGCTGCCGGAGCCGG + Intergenic
1113657535 13:112077863-112077885 GCGGCAGGGGCTGCAGGGGCAGG - Intergenic
1113861251 13:113489201-113489223 GAGGTTGGAGATCCAAGAGCAGG - Intronic
1113937622 13:114002761-114002783 GCGCCTGGCTCTCCAGGAGTCGG + Intronic
1114140210 14:19901230-19901252 GCGGCTGGAACTGAAGCAGCCGG - Intergenic
1114736749 14:25050097-25050119 GCAGCTGGAGCTCCAGCGCCCGG - Exonic
1114806219 14:25840244-25840266 GGGTCTGGAGCTCAAGGAGGAGG - Intergenic
1114866198 14:26597990-26598012 GCGGCGGCAGCACCAGCAGCGGG - Intergenic
1116835751 14:49768023-49768045 GCGGCTGGAGGACCCGGCGCTGG + Exonic
1117106808 14:52405643-52405665 GCAGCTGCAGCTCCAGGGTCTGG - Intergenic
1117366951 14:55038541-55038563 GCTGCTGGAGTTCTGGGAGCTGG + Intronic
1118366795 14:65102870-65102892 GGAGCTGGAACTCCTGGAGCCGG + Intergenic
1118520395 14:66576235-66576257 GAGGCTGGGGCCACAGGAGCTGG + Intronic
1118849343 14:69572476-69572498 GCGGCGGGAGCGCGAGGAGCGGG - Exonic
1121310415 14:92932629-92932651 GCGGCTGGAGGGGCAGGAGGAGG + Exonic
1122130744 14:99603518-99603540 GAACCTGGAGCTCAAGGAGCTGG - Exonic
1122130915 14:99604237-99604259 GCGGCGGGGGCTCCGGGAGCTGG - Intergenic
1122228402 14:100292819-100292841 GCGGCTGCAGCTGCAGGACGCGG - Exonic
1123473713 15:20572324-20572346 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123644296 15:22428029-22428051 GCTGCTGGAGCTGCAGGAGATGG - Intergenic
1123665592 15:22607832-22607854 GGGGCTGGGGCTCCTGGACCGGG + Intergenic
1123665605 15:22607928-22607950 GCTGCTGGAGCTGCAGCAGATGG - Intergenic
1123734013 15:23167335-23167357 GCTGCTGGAGCTGCAGGAGATGG + Intergenic
1123752151 15:23364724-23364746 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1123752164 15:23364820-23364842 GGGGCTGGGGCTCCTGGACCGGG - Exonic
1124284516 15:28388646-28388668 GCTGCTGGAGCTGCAGGAGATGG + Exonic
1124298181 15:28522968-28522990 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124319430 15:28702342-28702364 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124483086 15:30093089-30093111 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124483097 15:30093185-30093207 GGGGCTGGGGCTCCTGGACCGGG - Exonic
1124489534 15:30145157-30145179 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124520486 15:30404033-30404055 GGGGCTGGGGCTCCTGGACCGGG + Exonic
1124520497 15:30404129-30404151 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124538160 15:30562090-30562112 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124538171 15:30562186-30562208 GGGGCTGGGGCTCCTGGACCGGG - Exonic
1124544626 15:30614151-30614173 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124544637 15:30614247-30614269 GGGGCTGGGGCTCCTGGACCGGG - Exonic
1124564581 15:30801580-30801602 GCTGCTGGAGCTGCAGCAGATGG + Intergenic
1124564594 15:30801676-30801698 GGGGCTGGGGCTCCTGGACCGGG - Intergenic
1124753993 15:32393170-32393192 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124760482 15:32445399-32445421 GGGGCTGGGGCTCCTGGACCGGG + Exonic
1124760493 15:32445495-32445517 GCTGCTGGAGCTGCAGCAGATGG - Exonic
1124778143 15:32603567-32603589 GCTGCTGGAGCTGCAGCAGATGG + Exonic
1124778154 15:32603663-32603685 GGGGCTGGGGCTCCTGGACCGGG - Exonic
1124959073 15:34381829-34381851 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1124975699 15:34528050-34528072 GCTGCTGGAGCTGCAGGAGATGG - Exonic
1125513915 15:40307545-40307567 GCTGCTGGAGCACCAGGTGGTGG - Intronic
1125587058 15:40828474-40828496 GCGGCTGGGTCTCCGGGACCTGG + Exonic
1125727171 15:41874030-41874052 GTGGCAGGAGCTCCAGGTGGAGG - Exonic
1125728865 15:41881965-41881987 GCGGCTGGAGGAGCAGGGGCGGG - Exonic
1126473920 15:49046457-49046479 GCGGCTCCAGCTCCGGGAGATGG + Exonic
1127793935 15:62422645-62422667 GCTGCTGGAGTGCCAGGAGATGG - Intronic
1127918722 15:63476520-63476542 GCAGCTGGAAGACCAGGAGCAGG + Intergenic
1127931020 15:63597616-63597638 GCGGCTGGAGTGCCAGCAGATGG - Exonic
1128322639 15:66703747-66703769 GCGGCTGCTGCTGCTGGAGCAGG + Exonic
1129038671 15:72665980-72666002 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129211220 15:74071250-74071272 GCTGCTGGAGCTGCAAGAGTTGG - Exonic
1129399183 15:75269837-75269859 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129402790 15:75294113-75294135 GCTGCTGGAGCTGCAAGAGTTGG + Exonic
1129476319 15:75786534-75786556 GCTGCTGGAGCTGCAGGAGCTGG + Intergenic
1129476340 15:75786628-75786650 GGGGCTGGGGCCCCTGGAGCGGG - Intergenic
1129670996 15:77607626-77607648 GAGGCTGGAGCTCCCGGGGGAGG + Intergenic
1129697072 15:77746853-77746875 GTCTCTGGAGCTCAAGGAGCTGG - Intronic
1129728353 15:77915524-77915546 TCTGCTGGAGCTGCAAGAGCTGG - Intergenic
1129774191 15:78223938-78223960 AATGCTGGAGCACCAGGAGCTGG + Intronic
1130667940 15:85885498-85885520 GAGGCTGGAGCAGCAGGAGACGG + Intergenic
1131092215 15:89631656-89631678 CCGGCTGGAGCACCTGGAGAAGG - Exonic
1131092452 15:89632918-89632940 GCGGCGGGCGCTGGAGGAGCTGG - Exonic
1131156886 15:90081029-90081051 GCGGCTGCACCTCCAGGGCCAGG - Exonic
1131507382 15:93030263-93030285 GCGGGTCCAGCTCCTGGAGCAGG - Intergenic
1131700544 15:94930856-94930878 CCGGCTAGAGCTCCAGGTACTGG + Intergenic
1132184670 15:99792670-99792692 GGGGCTGGGGCTCCTGGACCAGG - Intergenic
1132303825 15:100794091-100794113 ACGGCTGGAGCTGAAGCAGCTGG + Intergenic
1132367538 15:101268348-101268370 GAGGCTGGAAGTCCAGGATCAGG - Intergenic
1132404586 15:101534785-101534807 GAGGCTGGAGATGCTGGAGCGGG + Intergenic
1132426737 15:101724327-101724349 GCGCCTGGAGCGGCAGGAGGAGG - Exonic
1132432313 15:101771984-101772006 GGGGCTGGGGCTCCTGGACCAGG + Intergenic
1132583129 16:694358-694380 GCTGCAGGAGCTGGAGGAGCTGG - Exonic
1132589551 16:720741-720763 GCGGCTGGAGCCCAGGGAGCCGG - Intronic
1132702819 16:1229299-1229321 CCTGCTGGAGCTGGAGGAGCCGG - Exonic
1132705507 16:1241569-1241591 CCTGCTGGAGCTGGAGGAGCCGG + Exonic
1132884265 16:2175681-2175703 GCAGATGGAGCCCCAGGTGCTGG - Intronic
1133234427 16:4381321-4381343 GCAGCTTGAGCTCCAGGAGGCGG - Exonic
1133303669 16:4797466-4797488 GGGTCTGTAGCTCCAGTAGCTGG + Exonic
1133733586 16:8596742-8596764 GCAGATGGAGCTGCTGGAGCTGG - Intergenic
1133993409 16:10728244-10728266 GCTGCTTGAGCTCCACGGGCTGG + Intergenic
1134080476 16:11321381-11321403 CCACCTGGAGCTCCAGTAGCCGG + Intronic
1134172107 16:11976854-11976876 GCAGCTGGAGCGGCGGGAGCCGG - Intronic
1134186322 16:12087900-12087922 GCGGCAGCAGCTCCACCAGCAGG - Exonic
1134644738 16:15857162-15857184 CCGGCGGGAGCGCAAGGAGCTGG + Intergenic
1135201599 16:20442233-20442255 GAGGCTGGAGGTCTAGGATCAGG + Intergenic
1135217507 16:20585633-20585655 GAGGCTGGAGGTCTAGGATCAGG - Intergenic
1135570337 16:23544542-23544564 GCGGCTGGAGCTCCTGAAGAAGG - Exonic
1135709276 16:24701235-24701257 GCAGGGGGAGCTTCAGGAGCTGG + Intergenic
1136608148 16:31350247-31350269 GTGCCTGGTGCTCCAGGGGCTGG - Intergenic
1137580596 16:49631434-49631456 GGGGCTGAAGCTGCAGGAGGAGG - Intronic
1137638537 16:50008651-50008673 GTGGCTGGAGCTGGAGTAGCTGG - Intergenic
1138130877 16:54478927-54478949 GCTGCTGGAGCTGCAGGTGTTGG - Intergenic
1138567784 16:57846152-57846174 GAGGCTGGACCTCCAGGGGCTGG + Intronic
1138582876 16:57952995-57953017 GCAGTTGGAGCTCCAGGGGTGGG - Intronic
1138782655 16:59807923-59807945 GCTACTGGGGCTCCAGGATCTGG - Intergenic
1139849303 16:69940990-69941012 CCTCCTGGAGCTCCAGGGGCTGG - Exonic
1139902615 16:70340211-70340233 GACGCTGGAGCTCAAGGATCAGG - Intronic
1141091490 16:81133351-81133373 GCGGGTAGAGCCACAGGAGCCGG + Intergenic
1141172789 16:81701779-81701801 GCAGCGGGAGCTGAAGGAGCTGG + Exonic
1141674727 16:85511770-85511792 ACACCTGGAACTCCAGGAGCTGG + Intergenic
1141847696 16:86622116-86622138 GGGGCCGGAGCTCCAGCAGGTGG - Intergenic
1141967532 16:87456398-87456420 GCTGCTGGGGCTACAGGTGCCGG - Intronic
1142212548 16:88815350-88815372 GAGGCTGAAGCTGCAGGAGAGGG - Intronic
1142257606 16:89022305-89022327 GCAGCTGGGGCTCCCGCAGCCGG - Intergenic
1142268248 16:89075244-89075266 GCAGCTGGAGCTGCAGGGGAGGG + Intergenic
1142431840 16:90032864-90032886 GAAGGTGGAGCTCAAGGAGCAGG + Exonic
1142890071 17:2937436-2937458 GAGGCTGGGGCTGCAGGAACGGG + Intronic
1142938765 17:3362947-3362969 ACAGCTGGAGCTGCAGCAGCTGG + Intergenic
1142967604 17:3591021-3591043 GCCGCGCGATCTCCAGGAGCAGG + Exonic
1143107033 17:4535102-4535124 GCAGCTGGAGCTCGGGGAACAGG + Intronic
1144021136 17:11240981-11241003 GCGACTGGCGCTCCGGGAGCAGG - Intergenic
1144225235 17:13138840-13138862 ATGGCTGGAGCTCAAGCAGCTGG - Intergenic
1144605209 17:16658621-16658643 GCGACTGGAGCTGCAGCAGCTGG + Intergenic
1144702118 17:17346857-17346879 GGGGCTGCAGCTGCAGGTGCTGG - Exonic
1145243494 17:21252976-21252998 GCGGCCGGAGCTCCGGGCGCGGG - Intronic
1145290837 17:21544562-21544584 ACCTCTGGAGCTCCAGGAGTTGG + Intronic
1145722807 17:27089083-27089105 GCGGCTGGAGCGGTAGGAGAAGG - Intergenic
1146941542 17:36847178-36847200 GCGCCTGGAGGACCAAGAGCAGG + Intergenic
1147514365 17:41101871-41101893 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147516584 17:41123673-41123695 GCTGCTGGAGATGCAGCAGCTGG + Exonic
1147517952 17:41140041-41140063 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147518887 17:41149378-41149400 GCAGCTGGAGATGCAGCAGCTGG + Exonic
1147520488 17:41167756-41167778 GCAGCTGGAGATACAGCAGCTGG + Exonic
1147768905 17:42854548-42854570 GCTGCTGGAGATGGAGGAGCAGG + Exonic
1147793072 17:43025265-43025287 GCGGCTGCAGTTGCAGGGGCGGG + Exonic
1148195059 17:45707275-45707297 GAGGCTGGAGCTGGATGAGCAGG + Intergenic
1148774467 17:50087889-50087911 GCTGGTGGAGGTCCCGGAGCAGG - Intronic
1149386361 17:56146644-56146666 GTGGCTGGAGCTGAAGCAGCTGG + Intronic
1149991155 17:61384275-61384297 GCGGAGGGCCCTCCAGGAGCGGG - Intronic
1150302188 17:64055867-64055889 GCTGCTGCTGCTGCAGGAGCTGG + Exonic
1151419717 17:73989203-73989225 GAGGCTGGAGCCCAAGGACCAGG - Intergenic
1151557703 17:74854900-74854922 GCGGCTGGATCTCCAGGGGTAGG + Exonic
1151580143 17:74972831-74972853 GCGGCGGGCGCTGCAGGTGCAGG - Intronic
1151602332 17:75113924-75113946 GGGCCTGGAGCTCCAGGTGCAGG + Intronic
1151709844 17:75797695-75797717 GCAGCAGGAGCTGCAGGAACAGG + Intronic
1151969556 17:77450723-77450745 GAGGCTGGAGAGGCAGGAGCTGG + Intronic
1151973048 17:77468903-77468925 GCAGCTAGATCTCCAGGGGCCGG - Intronic
1152222189 17:79074992-79075014 GCGGCGGCAGCTGCAGGGGCTGG + Exonic
1152398547 17:80049968-80049990 GAAGCTGGACCTCCAAGAGCTGG + Exonic
1152608087 17:81303003-81303025 GCAGCTGAGGCTCCAGGAGGAGG + Intergenic
1152655553 17:81517739-81517761 GCGGCCGGAGCTCCTGGGGTGGG - Intronic
1152728581 17:81959391-81959413 CTGGCTGGGGCTCCAGGAGGCGG + Intronic
1152799081 17:82322769-82322791 CCTGCTGGGGCTCCAGGAGAGGG - Intronic
1153447071 18:5186039-5186061 GCAGCTGGAGCTGTAGGAGCTGG + Intronic
1155086397 18:22463372-22463394 GCATGTGGAGCTACAGGAGCAGG - Intergenic
1155087289 18:22470976-22470998 AGGGCTGGAGCCCCAGAAGCTGG + Intergenic
1155959940 18:31985713-31985735 GAGGCTGGAAGTCCAAGAGCAGG - Intergenic
1156418966 18:36929806-36929828 GCAGCTGGAAGTCCAGGATCAGG - Intronic
1157319537 18:46623732-46623754 GTGGCTGGTGCACCAGGCGCAGG - Intronic
1157916119 18:51665321-51665343 GTGGCTGGAGCACCATGAGTGGG - Intergenic
1159040545 18:63319949-63319971 GCGGCGGGAGCTCCGGGAGGCGG - Exonic
1159265262 18:66071960-66071982 GTGGCTGGAGCTGGAGCAGCTGG - Intergenic
1159359537 18:67382023-67382045 GCGGCTGAAGCTCTAGGAATAGG - Intergenic
1159901130 18:74046736-74046758 GAGGCTGGAGGTCCAAGATCAGG - Intergenic
1160345548 18:78129116-78129138 ACTGCTGGAGCCCCAGAAGCTGG + Intergenic
1160443579 18:78911537-78911559 GGGGCTGGAGCTGGAGGACCTGG - Intergenic
1160443609 18:78911620-78911642 GGGGCTGGAGCTGGAGGACCTGG - Intergenic
1160493167 18:79354768-79354790 GCAGCTGGAGCTGAAGGAGCCGG + Intronic
1160497464 18:79383722-79383744 GGGGCTGGAGCTGCAGGCTCTGG - Intergenic
1160524714 18:79528473-79528495 GCGACTGGAGCCCCAGACGCAGG - Intronic
1160535634 18:79589963-79589985 GGGTCCGGAGCTCCAGGATCTGG - Intergenic
1160699172 19:497858-497880 GCAGGTGGAGCCCCCGGAGCCGG + Exonic
1160724348 19:610954-610976 GCGCCTGGAGCCCCAGACGCCGG - Intronic
1160745474 19:709183-709205 GGGCCCGGAGCTCCGGGAGCCGG + Intronic
1160789461 19:916969-916991 GGGGCTGGGGCTCCAGGGGGTGG - Intergenic
1160792619 19:929570-929592 GCAGCGGGCGCGCCAGGAGCTGG + Exonic
1160845219 19:1163338-1163360 GCGCCTGGAGCCCCGGAAGCTGG + Intronic
1161384285 19:3982750-3982772 GCAGCGGGATCTGCAGGAGCCGG - Intronic
1161448247 19:4329762-4329784 AGGGCAGGATCTCCAGGAGCGGG - Intronic
1162100356 19:8335187-8335209 GCTGCCCGAGCTGCAGGAGCAGG - Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1163128400 19:15256963-15256985 GCTGGCTGAGCTCCAGGAGCAGG - Exonic
1163287113 19:16355758-16355780 GCGGCTGCGGCGGCAGGAGCAGG - Exonic
1164105350 19:22105378-22105400 GCGGCTGGCGGGCCAGGGGCTGG - Intergenic
1164156983 19:22602983-22603005 GCTGCTGGAGTTGCAGGAGCTGG + Intergenic
1164157001 19:22603080-22603102 GGGGCTGGGGCCCCTGGAGCTGG - Intergenic
1164411788 19:28012388-28012410 GTGGCTGGAGATCCGGGAGGTGG - Intergenic
1165464714 19:35966930-35966952 GCGGCTGCAGCTACAGGTTCAGG - Intergenic
1165683868 19:37801136-37801158 GCGGCTGGAGCTGCAGCCTCTGG - Intronic
1166216143 19:41336469-41336491 TTGGCTTGAGCCCCAGGAGCTGG - Intronic
1166232219 19:41431528-41431550 CCGCCTGGTGCTTCAGGAGCTGG + Intronic
1166326050 19:42051824-42051846 GCGGCAGGAGGGGCAGGAGCTGG - Intronic
1166331171 19:42078873-42078895 GCTCCTGGTGCTCCAGGAGCTGG - Exonic
1166677256 19:44747714-44747736 GAGGCCGGTGCTGCAGGAGCGGG - Intronic
1166736328 19:45087485-45087507 GGGGCTGGAGATCCAGCAGTGGG + Intronic
1166898070 19:46036441-46036463 GCAGCTGCAGCTGCAGGGGCAGG - Intergenic
1166988160 19:46674702-46674724 GTGGCTGGACCTCCGAGAGCTGG - Exonic
1167145998 19:47681072-47681094 GCTGCTGGAGGCCCAGGGGCAGG - Exonic
1167233073 19:48297500-48297522 GCAGGTGGAGCTCCAGGAGCAGG - Exonic
1167258223 19:48443402-48443424 GGGGCTGGCGCGCCGGGAGCTGG + Exonic
1167288222 19:48610736-48610758 GCTGCTGGCGGTCCAGGAGCAGG + Exonic
1167356986 19:49010382-49010404 GAGACTGGAGCTCCAGGAAATGG - Intronic
1167586959 19:50380754-50380776 GCAGCTGGAGCACAAGGAGATGG + Intronic
1168217916 19:54939870-54939892 TCGGCTGCTGCGCCAGGAGCTGG + Exonic
1168269435 19:55241572-55241594 GCAGCTGGAGCTCCTGGCCCAGG - Exonic
1168687399 19:58357189-58357211 GAGGTTGGAGCTCCAGGCGAAGG + Exonic
925367071 2:3317879-3317901 GAGGCTGGAGCTTCAGGGTCAGG - Intronic
925474941 2:4203035-4203057 GAGGCTGGAGGTCCAAGATCAGG + Intergenic
926087733 2:10030518-10030540 GAGGCTGGAAATCCAGGATCAGG - Intergenic
926128165 2:10284559-10284581 GGGGCTGGAGCACCAGGAAAGGG - Intergenic
926216987 2:10912020-10912042 GCGGCGGCAGGTCCCGGAGCTGG - Exonic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
927881531 2:26692992-26693014 GCGGCTGGAGCTGCGGCAGCAGG + Exonic
928085680 2:28345011-28345033 TGGGCTGGAGTCCCAGGAGCGGG - Intergenic
929600172 2:43199774-43199796 GGGGCTGGAGAAGCAGGAGCTGG + Intergenic
932737453 2:74264240-74264262 GCGGCCAGAGCTCCGGGAGAGGG - Exonic
932763711 2:74457429-74457451 GCTGCTGAAGCGCGAGGAGCGGG + Exonic
932803914 2:74766919-74766941 GTGGCTGGAGCTAGAAGAGCAGG - Intergenic
935318225 2:101859049-101859071 GCAGCAGCTGCTCCAGGAGCAGG + Exonic
937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG + Intergenic
937264098 2:120605361-120605383 GCGCCTGGAGGTGCAGGAGTTGG - Intergenic
938381512 2:130838824-130838846 GCCCCAGAAGCTCCAGGAGCAGG + Intronic
938661541 2:133491999-133492021 GGGGCAGGAGCTCCTGGAGAAGG - Intronic
938907654 2:135854095-135854117 GCAGCTGGAACTACAGGTGCAGG - Intronic
940533130 2:154905023-154905045 ACGGCTGGAGCTGAAGCAGCTGG + Intergenic
942713611 2:178865859-178865881 GCAGCTGGAGCTCCTTGAGGAGG - Exonic
945407978 2:209473028-209473050 GCAGTCTGAGCTCCAGGAGCAGG + Intronic
946295761 2:218782300-218782322 GCCACCGGAGCTCCCGGAGCCGG + Exonic
946427816 2:219608713-219608735 GCGACTGGAGCTCCAGAGTCTGG + Exonic
946692269 2:222318987-222319009 GGGGCTGGAGGTGCAGGCGCCGG + Intergenic
947674008 2:231961407-231961429 GAGCCTGGAGGTTCAGGAGCCGG + Intronic
947873657 2:233453781-233453803 GCTGGGGGAGCTGCAGGAGCAGG + Intronic
948716120 2:239864854-239864876 GAGGCTGGAAGTCCAGGATCAGG - Intergenic
1169091254 20:2862605-2862627 CCTGCGGGAGATCCAGGAGCTGG + Exonic
1169253036 20:4074778-4074800 CAGCCTGGAGCTCCAGGAGGAGG - Exonic
1170438091 20:16350705-16350727 GCGGATGGAGCATGAGGAGCTGG + Intronic
1170938529 20:20829947-20829969 GTGGCTGGAGCTGGAGCAGCTGG - Intergenic
1170953427 20:20956745-20956767 GCGGCAGGAGTTCAGGGAGCCGG - Intergenic
1171001906 20:21423443-21423465 ACGGCTGGAGCTACAGTGGCTGG + Intergenic
1171146801 20:22791646-22791668 GTGCCTGGAGCTCCAGAAGTAGG + Intergenic
1172033496 20:31996913-31996935 GCGGCTGGAGTACCAGAAGCCGG - Exonic
1172446802 20:34997436-34997458 GCGGCGGGAGCTGGAGGAGGCGG + Exonic
1172522725 20:35578835-35578857 GCTGCAGGAGCTCCAGGGGCAGG - Intergenic
1173101369 20:40091813-40091835 ACAGCTGGAGCTGGAGGAGCAGG + Intergenic
1173454062 20:43189682-43189704 GCAGCTGCAGCCTCAGGAGCAGG + Exonic
1173519998 20:43692262-43692284 GCTGCTGGAGCTCGAGGACAAGG + Exonic
1173663850 20:44751922-44751944 GCGGCTGCTGCTCCAAGAGAGGG + Exonic
1174021670 20:47535311-47535333 GCCACTGGGGCTTCAGGAGCTGG - Intronic
1174887534 20:54352315-54352337 GAGGCTGGAAGTCCAGGATCAGG + Intergenic
1175276367 20:57773896-57773918 GTCCCTGGAGCTCCTGGAGCTGG + Intergenic
1175503567 20:59466899-59466921 GCGGCTGGGGCTGCAGGGGCAGG + Intergenic
1175878766 20:62244296-62244318 GCGGCTGCAGCTAGAGGAGAAGG - Intronic
1176100852 20:63363867-63363889 GAGGGTGGAGCTCCAGAATCTGG - Intronic
1176107407 20:63395886-63395908 GCGGCCGGGGCTGCAGGAGGAGG + Intergenic
1179539682 21:42076113-42076135 GCGGCTGGATCCCCTGGAGGCGG + Exonic
1179893803 21:44350588-44350610 GCGGGTGGGGCTCGAGGCGCTGG + Intronic
1179936975 21:44612258-44612280 GCAGCTGGAGGCACAGGAGCGGG - Exonic
1179959199 21:44758833-44758855 GCGGCAGGCGCCCCAGGAGTGGG + Intergenic
1180061015 21:45385114-45385136 GGAGCTGGAGCTGCTGGAGCTGG - Intergenic
1180074423 21:45455499-45455521 GCGGCTGGAGCTGCGGGCGGCGG - Exonic
1180222749 21:46369851-46369873 GGTGCTGATGCTCCAGGAGCAGG - Intronic
1180228891 21:46414540-46414562 GCGGCTGCATGTCCAGGAGGAGG - Intronic
1180228958 21:46414795-46414817 GCGGCTGCATGTCCAGGAGGAGG - Intronic
1180614707 22:17119960-17119982 GCCGCTGGGGCTGCAGCAGCAGG + Exonic
1180796773 22:18609673-18609695 GCGGCGCGAGTGCCAGGAGCTGG - Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181001456 22:19989637-19989659 GCGGGTGGAGGTGCAGGTGCTGG + Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181224951 22:21385598-21385620 GCGGCGCGAGTGCCAGGAGCTGG + Exonic
1181253681 22:21549215-21549237 GCGGCGCGAGTGCCAGGAGCTGG - Exonic
1181435653 22:22909136-22909158 AAGGCAGGAGCTACAGGAGCTGG + Intergenic
1181572114 22:23773241-23773263 GCGGCTGGAGCGCGAGAGGCAGG - Intronic
1182321006 22:29478684-29478706 GCGGCTGGCGCTTCAGCACCGGG - Intergenic
1182696343 22:32201687-32201709 GCAGCTGGAGCCCCAGAACCTGG - Intronic
1182715795 22:32355391-32355413 GCAGCTGGAGCCCCAGAACCTGG + Intronic
1183292368 22:37010580-37010602 GAGGCTGGGGCTACAGCAGCTGG + Intergenic
1183604840 22:38862303-38862325 GGGGCTAGAACTCCAGGAGAGGG - Exonic
1183641704 22:39096820-39096842 GCAGCTGGAACTACAGGCGCAGG + Intergenic
1183731783 22:39622428-39622450 GGGGAGGGAGCTGCAGGAGCTGG + Intronic
1184396285 22:44243568-44243590 GCGGGTGGAGGACCAGGGGCTGG - Intergenic
1184406787 22:44304962-44304984 GGAGTTGGAGCACCAGGAGCAGG - Intronic
1184407504 22:44308418-44308440 AGGGCTGAAGCTCCAGGAACAGG - Intronic
1184808070 22:46809132-46809154 GAGGCTGGAAGTCCAGGACCGGG + Intronic
1185053850 22:48567762-48567784 GTGGCTGGGGCTGCAGGAACAGG + Intronic
1185148863 22:49153107-49153129 CCACCTGGAGCTCCAGGTGCTGG - Intergenic
1185320678 22:50198967-50198989 TCGGCTGGAGCTCCAGGGCTGGG - Exonic
1185385693 22:50530525-50530547 GCGGCTGGAGTTTCGGGATCCGG - Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950548612 3:13653481-13653503 TGGGCTGGGGCTCCAGGGGCAGG + Intergenic
950624855 3:14237679-14237701 CCGGCTGGAGCTAGAGAAGCTGG - Intergenic
950668018 3:14509077-14509099 GCAGGGGGCGCTCCAGGAGCAGG + Intronic
950894274 3:16433960-16433982 GCTGGTACAGCTCCAGGAGCTGG + Exonic
951258784 3:20482202-20482224 CAGGCTGGAGCCCCAGGAGAGGG - Intergenic
953224929 3:41009976-41009998 GAGGCTGGGTCTGCAGGAGCTGG + Intergenic
953418281 3:42735376-42735398 GTGGCAGTAGCTCCAGCAGCAGG - Intronic
953793742 3:45967416-45967438 GCAGCTTGCCCTCCAGGAGCTGG + Exonic
953998123 3:47536238-47536260 GAGGCCAGAGCTCCAGGACCCGG - Intergenic
954005621 3:47588222-47588244 GAGGCTGGCGGGCCAGGAGCAGG + Exonic
954361612 3:50125410-50125432 GGGGCAGGAGCTCCAGGAGGAGG + Intergenic
955355044 3:58224280-58224302 GTGGCTTGAGCCCCAGGAGGTGG - Intergenic
955395536 3:58554498-58554520 GTGGCTGGAGCTGGAGCAGCTGG + Intergenic
956868024 3:73388330-73388352 GGGGCTGGACCTCCAGAAGACGG + Intronic
959508236 3:107178255-107178277 ACAGCTGGAGCTGGAGGAGCTGG + Intergenic
959857668 3:111178579-111178601 GAGGCTGGAGCTCAAGCAGGAGG + Intronic
961539737 3:127591207-127591229 GCGGCTGGAGCGCGTGGCGCCGG - Intronic
962247239 3:133805926-133805948 GCGGCAGGAGCTGCAGCAGACGG + Exonic
962301854 3:134250515-134250537 GCGGCGGCAGCGCCAGGCGCGGG + Exonic
962722395 3:138187797-138187819 CCGGCGGGAGCTCCCGGAGTTGG - Intronic
963980902 3:151535928-151535950 GCAGCTGGAGCTCCATGTACAGG - Intergenic
964477446 3:157109771-157109793 GGGCTTGCAGCTCCAGGAGCTGG - Intergenic
964744749 3:160001866-160001888 GCGGCTGCAGAGCCAGGATCAGG + Intergenic
965502891 3:169477586-169477608 CTGACTGCAGCTCCAGGAGCAGG - Intronic
965672060 3:171157546-171157568 GCAGCTGGAGCAGCAGCAGCGGG - Exonic
966849492 3:184155815-184155837 GCGGCCGGGGCTCCCGGAGGCGG - Intronic
967304240 3:188045392-188045414 GAGGCTGGAAGTCCAGGACCAGG + Intergenic
968010378 3:195270578-195270600 GCGGCAGGAGCTCCCGCAGCAGG + Exonic
968133098 3:196203638-196203660 GAGGCTGGAGATCCTGGATCAGG + Intronic
968578986 4:1380957-1380979 GCGGCGGCAGCTGCAGAAGCAGG + Exonic
968608009 4:1544684-1544706 GAGGCTGGAGGTCTAGGATCCGG - Intergenic
968894841 4:3393423-3393445 GTGGCTGGAGCTGCAGGTGCAGG - Intronic
968949723 4:3684231-3684253 AGGGAAGGAGCTCCAGGAGCGGG - Intergenic
968956940 4:3724272-3724294 TCGGCTGGAGCTGCAGGAGGGGG - Intergenic
969483928 4:7461279-7461301 GCGTCTGCAGCCCCTGGAGCTGG + Intronic
969485104 4:7467783-7467805 GCTGCTGTGGCTCCCGGAGCCGG + Intronic
969625006 4:8297890-8297912 GCAGGTGGGGCTGCAGGAGCAGG - Intronic
973888467 4:55346423-55346445 GCGGCAGGAGCTGCAGCAGTAGG - Exonic
974385595 4:61200282-61200304 GCGGCAAGAGCTCCGAGAGCCGG - Intergenic
974607600 4:64173605-64173627 GCGGCAGGAGCGCCAGGCTCTGG + Intergenic
975430743 4:74287941-74287963 GAGGCTGGAAGTCCAGGATCAGG + Intronic
975455220 4:74582390-74582412 GAGGCTGGAGGTCCAAGATCAGG - Intergenic
976074720 4:81284742-81284764 GCGGCTGGAGCAGAGGGAGCTGG - Intergenic
976160539 4:82193814-82193836 GAGGAAGGAGCTCCAGGAGAAGG - Intergenic
976161971 4:82211256-82211278 GCAGCTGGTACTCCAGGGGCAGG - Intergenic
979378786 4:119983451-119983473 GTTCCTGGAGCTCCAGGAGCAGG - Intergenic
981337095 4:143580540-143580562 GCAGCAGGAGCTCCAGAGGCTGG - Intronic
981550596 4:145937725-145937747 GCGGCTGGAGCAGGAGGAGGCGG - Intronic
983020482 4:162670104-162670126 ACGGCTGGAGCTGAAGCAGCTGG + Intergenic
984951278 4:185009549-185009571 GCCCCTGGAGCCCCAGAAGCTGG + Intergenic
985509548 5:305077-305099 GGAGCTGCAGCTCCAGGGGCAGG + Intronic
985566343 5:620236-620258 GCTGCTGGAGCTTGGGGAGCAGG - Exonic
985738727 5:1601814-1601836 GGAGCTGCAGCTCCAGGGGCAGG - Intergenic
985763799 5:1765820-1765842 GCTGCTGGAGCTCCAGATGTGGG + Intergenic
985796273 5:1964310-1964332 GCAGCTGGACCTCACGGAGCTGG + Intergenic
985971268 5:3380601-3380623 GCACCTGGAACTCCAGAAGCTGG + Intergenic
985992234 5:3572866-3572888 GGGGCTGGTGCACCAGCAGCAGG - Intergenic
986557652 5:9027335-9027357 ACGGCTGGAGCTGAAGCAGCTGG - Intergenic
987849986 5:23339398-23339420 GCAGCTGGGACTACAGGAGCAGG + Intergenic
988100460 5:26669800-26669822 GCAGCTGAAGGTGCAGGAGCTGG - Intergenic
989484084 5:41968009-41968031 GCGGCAGGAGGTGGAGGAGCAGG - Intergenic
989512068 5:42299752-42299774 GAGGCTGGAGATCCAAGTGCTGG - Intergenic
990449718 5:55923348-55923370 CCAGCGGCAGCTCCAGGAGCGGG - Intergenic
990950194 5:61291112-61291134 GAGGCTGGAGCTACAGGAAGTGG - Intergenic
993852211 5:93024300-93024322 GTGGCTGGAGCTCACAGAGCCGG + Intergenic
994631811 5:102296367-102296389 GAGGCTGGAGGGCCAGGAGGCGG - Exonic
996584837 5:125074727-125074749 GCACCTGGAGCTCCAGGAAGGGG + Intergenic
997022068 5:130013623-130013645 GCAGCTGGAGCTAAAGCAGCTGG + Intronic
997583936 5:135033895-135033917 GCGGCGGGCGCTCCAGGGGCCGG + Exonic
997681842 5:135761939-135761961 GCTGCTTGAGCTCCATGGGCTGG + Intergenic
997897876 5:137736045-137736067 GAGGCAGGAGCCCCAGGGGCGGG - Exonic
998011594 5:138699704-138699726 GTGGCTGGAGCTGGATGAGCAGG + Intronic
998141532 5:139702278-139702300 GTGGCTGGAGCAGAAGGAGCAGG - Intergenic
998279779 5:140795120-140795142 GGGGCTGGAGCTGGAGGAGCTGG + Exonic
998280360 5:140801353-140801375 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998282748 5:140828247-140828269 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998283341 5:140834539-140834561 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998284051 5:140841477-140841499 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998284707 5:140848651-140848673 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998285439 5:140856201-140856223 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998285608 5:140857608-140857630 GCCGCTGGACCACGAGGAGCTGG + Exonic
998286652 5:140869259-140869281 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998287290 5:140875628-140875650 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998287950 5:140882424-140882446 GGGGCTGGAGCTGGCGGAGCTGG + Exonic
998332763 5:141344189-141344211 GGGGCTAGAGCCCCGGGAGCTGG + Exonic
998335070 5:141364486-141364508 TGGGCTGGAGCCCCAGGAGCTGG + Exonic
998336157 5:141374239-141374261 GGGACTGGAGCCCCAGGAGTTGG + Exonic
998337105 5:141383055-141383077 GGGGCTGGAGCCCCGGGAGCTGG + Exonic
998341434 5:141421386-141421408 GGGGCTGGAGCCCCGGGAGCTGG + Exonic
1000000425 5:157133612-157133634 GAGGTTGGAGCTTCAGAAGCAGG - Intronic
1000784619 5:165528454-165528476 ACGGCTGGAGCTGAAGCAGCTGG - Intergenic
1002123358 5:177022810-177022832 GTTGCTGGAGGGCCAGGAGCCGG + Exonic
1002428059 5:179187339-179187361 GCCGCTGGAGCACAGGGAGCAGG - Intronic
1006183453 6:32167408-32167430 GCGCCTGGAGCGGCTGGAGCAGG + Exonic
1006396211 6:33789068-33789090 GCGGCGGGAGCTGCAGGCCCTGG - Exonic
1006444785 6:34074096-34074118 GGGGCTGGATCTCGAGGTGCAGG + Intronic
1006581427 6:35079817-35079839 GCAGCTGGACCTTCAGGACCTGG - Exonic
1006749319 6:36366689-36366711 GCCGCTGGAGAGCCAGGAGCAGG - Exonic
1007072529 6:39048081-39048103 GAGGCTGGAGCTGCAAGAGGTGG + Intergenic
1008929366 6:56922274-56922296 GCGGCTGCAGCTCCATGGGCTGG - Intronic
1009670850 6:66748055-66748077 GTGGCAGCAGCTACAGGAGCAGG + Intergenic
1010880536 6:81163958-81163980 GTAGCTGGGGCTCCAGGTGCAGG - Intergenic
1010900530 6:81422664-81422686 ACGGCTGGAGCTGAAGCAGCTGG - Intergenic
1012064905 6:94537677-94537699 ACGGCTGGAGCTGAAGCAGCTGG + Intergenic
1013048488 6:106510545-106510567 ACGGCTGGAGCCCCAGGGGCCGG - Intergenic
1014164496 6:118208211-118208233 GGGGCTGGAGCACCAGGATAAGG + Intronic
1015376143 6:132512828-132512850 GCCGCAGGCGCTCCGGGAGCTGG + Intronic
1015544937 6:134352161-134352183 GCAGCTGGAGGGCTAGGAGCTGG - Intergenic
1015571062 6:134621905-134621927 GCTGCTGGAGCTCCCTGACCAGG - Intergenic
1015790016 6:136957373-136957395 CCGACTGGAGCTCAAGGAGGAGG + Intergenic
1015924040 6:138291984-138292006 GCGGCGGGAGCCTCATGAGCGGG + Exonic
1016257023 6:142119390-142119412 TTGGCTGGTGCCCCAGGAGCTGG + Intergenic
1017987917 6:159460672-159460694 GTGGCTGGAGCTGCAGGAGCAGG - Intergenic
1018152334 6:160951925-160951947 ACGGCTGGAGAGACAGGAGCAGG + Intergenic
1018174129 6:161164359-161164381 GGGGATGGAGTTGCAGGAGCTGG - Intronic
1018926373 6:168209631-168209653 GAGGCTGGTTCTCCAGGGGCAGG - Intergenic
1019183599 6:170208246-170208268 AGGGATGGAGCTCCAGGAGCTGG - Intergenic
1019197573 6:170291229-170291251 GCGGCACCAGCTCCAGAAGCAGG - Intergenic
1019459995 7:1152793-1152815 GGGGCTGGAGGTCCAGGCGCAGG - Intronic
1019751159 7:2730643-2730665 GCGGCTGGGGCTGCAGGGCCGGG + Exonic
1021610644 7:22454673-22454695 GCTGCAGGTGCTGCAGGAGCTGG + Intronic
1022099492 7:27160836-27160858 GGGGCTGCAGCTCCAGGCGCGGG - Intergenic
1022286006 7:28956669-28956691 GCAGCCGCAGCTCCAGCAGCAGG - Exonic
1022505959 7:30908750-30908772 GCCGCTGGAGCCCCAGGCCCAGG - Intergenic
1023353063 7:39339661-39339683 GGAGCTGGAGCTGCTGGAGCTGG - Exonic
1024085535 7:45889018-45889040 GCGGCAGGAGGTGCTGGAGCAGG - Intronic
1024929784 7:54657919-54657941 GAGGCTGGAGCTCGAGGTGGAGG - Intergenic
1025258288 7:57399841-57399863 GCTGCAGGAGCCGCAGGAGCTGG + Intergenic
1025610347 7:63071889-63071911 GCTGCAGGAGCTGCAGGAGCTGG - Intergenic
1026762665 7:73138109-73138131 GTGGCAGGAACTACAGGAGCTGG + Intergenic
1027039130 7:74947896-74947918 GTGGCAGGAACTACAGGAGCTGG + Intergenic
1027084514 7:75254481-75254503 GTGGCAGGAACTACAGGAGCTGG - Intergenic
1027232990 7:76282764-76282786 GCGGCTGGAGCTCCAGGAGCGGG - Exonic
1027624317 7:80528452-80528474 GAGGGTGGGGCTACAGGAGCTGG - Intronic
1028844140 7:95460915-95460937 ATGGCTGGAGCTTCAGCAGCTGG - Intergenic
1029110520 7:98211282-98211304 GCGCCTGGGGCTCCCGGACCAGG - Intergenic
1029392091 7:100282291-100282313 GTGGCAGGAACTACAGGAGCTGG - Intergenic
1030216015 7:107044652-107044674 GCGGCTGGAGCGGGAGGAGCAGG + Exonic
1030249777 7:107429511-107429533 ACTGCTTGAGCTCCAGGAGTTGG - Intronic
1032021370 7:128408760-128408782 GCGGCCTGAACCCCAGGAGCTGG + Intronic
1032125377 7:129189187-129189209 GCAGCAGCAGCCCCAGGAGCGGG - Exonic
1032798721 7:135301066-135301088 GCCTCTGGAGCTCCAGTTGCTGG + Intergenic
1033164358 7:139026755-139026777 GCAGCTGGAGCTGCAGAAGCTGG - Exonic
1033477114 7:141701988-141702010 GAGGCGGGAGCCCGAGGAGCCGG - Exonic
1033903236 7:146168956-146168978 GCGGCTGGAGCTGAGTGAGCAGG - Intronic
1034937985 7:155211995-155212017 GAGGCTGGTGCTGCAGGAGCTGG - Intergenic
1036656399 8:10679949-10679971 GAGGCTGGAGCTGCCGGAGAGGG + Intronic
1039067062 8:33617868-33617890 GAGGCTGGGTCTACAGGAGCAGG + Intergenic
1039309207 8:36297595-36297617 GCGGCTGGAGCTGAGGCAGCTGG - Intergenic
1040284193 8:46091686-46091708 GTGGCTGGAGCCCCAGGCTCTGG + Intergenic
1040386654 8:46918901-46918923 GCTGGGTGAGCTCCAGGAGCAGG - Intergenic
1041491479 8:58438065-58438087 GCGGCTGGAGATGCAGCAGCTGG - Intronic
1041739586 8:61144191-61144213 GGGGCTGGAGGTCTAGGAGGAGG - Intronic
1042224585 8:66505404-66505426 GGGGCAGCAGCTCCAGGGGCTGG - Exonic
1042271563 8:66961622-66961644 GCGGCTCGCGTTCCGGGAGCGGG - Exonic
1043982422 8:86657724-86657746 GCTGCAGGAGCTGCAGGAGCTGG - Intronic
1044988525 8:97775702-97775724 GTGCTTGGAGCTCCAGCAGCTGG + Exonic
1045276056 8:100706757-100706779 GCGGCTGCAGCTGCAGGACGTGG + Exonic
1045277899 8:100722875-100722897 ACCGCTGGAGCTCCCGGCGCGGG + Intergenic
1045337740 8:101223941-101223963 GCGGCGGGACCTTCGGGAGCGGG + Intergenic
1046311265 8:112440792-112440814 GTGGCTGGAGCTGAAGCAGCTGG + Intronic
1047254971 8:123207604-123207626 GCGGCTGCAGCTGGAGCAGCTGG + Exonic
1047807236 8:128373210-128373232 GCTGCTGGAGATGCAGGTGCTGG + Intergenic
1048214389 8:132481283-132481305 CCCACGGGAGCTCCAGGAGCCGG - Intergenic
1048502316 8:134989362-134989384 GAGGCTGGATCTCAAGGATCTGG + Intergenic
1048697957 8:137049782-137049804 GCTGCTGGAGCTGCTGGAGCTGG - Intergenic
1049295292 8:141830084-141830106 GAGCCTGGAGCTCCAGGTGCCGG + Intergenic
1049466240 8:142752418-142752440 GCGGCTGGCGCTCCTGGCGCTGG - Exonic
1049674505 8:143883697-143883719 GCGGCTGGAGCCCGAGGGCCAGG - Intergenic
1049711132 8:144063883-144063905 GCGGCAGGAGATCCAGCGGCTGG - Intergenic
1049742786 8:144249047-144249069 GCGGGGGGTGCTCCAGGAGAAGG + Intronic
1049788233 8:144461534-144461556 GCAGCCAGTGCTCCAGGAGCCGG - Intronic
1050878998 9:10675662-10675684 GTGGCTGCAGCTCCAGCAACAGG - Intergenic
1051502618 9:17794456-17794478 GCAGCTGTGGCTCCTGGAGCTGG + Intronic
1052716132 9:32119787-32119809 GTGGCTGGAGCTGCATGAGAAGG + Intergenic
1052888861 9:33677114-33677136 GCGGCTGCAGCTCCAGGGAGGGG - Intergenic
1053882681 9:42611641-42611663 GTGGCTGGAGCTGAAGCAGCTGG + Intergenic
1053889988 9:42682661-42682683 GTGGCTGGAGCTGAAGCAGCTGG - Intergenic
1054221708 9:62419109-62419131 GTGGCTGGAGCTGAAGCAGCTGG + Intergenic
1054229006 9:62490064-62490086 GTGGCTGGAGCTGAAGCAGCTGG - Intergenic
1056580077 9:87884005-87884027 GAAGCGGGAGGTCCAGGAGCAGG + Exonic
1057135835 9:92687197-92687219 GCAGCAGGTGCTCCAGGAGTAGG - Intergenic
1057138951 9:92715318-92715340 GCGGCTGGAGCTGCTCGAGCTGG - Exonic
1057164896 9:92917662-92917684 GAGGCTGCAGCTCACGGAGCTGG - Intergenic
1057207289 9:93181165-93181187 GCAGATGCAGTTCCAGGAGCTGG - Intergenic
1057212318 9:93206850-93206872 GCGGCTGGATGTGCAGCAGCTGG + Intronic
1057245632 9:93451972-93451994 GCCGGTGGAGCTGCAGAAGCTGG + Exonic
1057258171 9:93567650-93567672 CCTACTGGAGCTTCAGGAGCGGG - Intergenic
1057300288 9:93874628-93874650 GAGGCTGGAGCTGGAGCAGCTGG + Intergenic
1057513067 9:95697069-95697091 GCAGCTGGACCTCAAGGAACTGG - Intergenic
1057801201 9:98192462-98192484 GCGGCTGCAGCTCCCGGAGAGGG - Intronic
1057806123 9:98221063-98221085 GCGGGTGGAGGCCCTGGAGCAGG - Exonic
1057869401 9:98707470-98707492 GGGGCTGGAGCGCGCGGAGCGGG - Intronic
1058976127 9:110127126-110127148 AAGGCTGGACCTGCAGGAGCAGG + Intronic
1059322990 9:113483615-113483637 GCAGCTGGGGTTCCAGGTGCTGG + Intronic
1060267587 9:122121388-122121410 GCTGCTGGAGCCCAAGGGGCTGG - Intergenic
1060522198 9:124300306-124300328 GTGGCCGGACCTCTAGGAGCTGG + Intronic
1060945823 9:127568978-127569000 GCGGCGGGAGCGGCGGGAGCGGG - Exonic
1061048229 9:128178928-128178950 GCAGCTGCAGCTGCAGAAGCAGG - Exonic
1061062455 9:128257498-128257520 GCTGCTGGAGCTGCAGGAGCTGG - Exonic
1061201389 9:129140469-129140491 GCCACTGGAGCTCCAGGACATGG + Intronic
1061220119 9:129245581-129245603 ACGGCTGGAGTTCAGGGAGCCGG - Intergenic
1061970391 9:134041759-134041781 GCTGGCGGAGCTGCAGGAGCAGG - Exonic
1062139346 9:134947355-134947377 GAGCCTGGAGCTCCCAGAGCCGG + Intergenic
1062192045 9:135253129-135253151 GCTCCTGGAGCTGGAGGAGCAGG + Intergenic
1062252186 9:135603905-135603927 GCAGCTGGAGCTCCCGGGGCTGG + Intergenic
1062400442 9:136370353-136370375 GCTGCGGGACCACCAGGAGCAGG - Exonic
1062587536 9:137255975-137255997 GCGGCTGGAGTTCCACCAGTCGG + Exonic
1062699650 9:137892249-137892271 GAGGCTGGAGGTCCAAGATCAGG + Intronic
1203760187 EBV:8886-8908 GTGGCTGAAGATCAAGGAGCGGG - Intergenic
1185543927 X:926555-926577 ACACCTGGAGCCCCAGGAGCTGG - Intergenic
1187133618 X:16526164-16526186 ATGGCTGGAGCTGCAGCAGCTGG + Intergenic
1187268763 X:17761148-17761170 GTGGCTGCAACTCCTGGAGCTGG + Intergenic
1187320713 X:18235178-18235200 GCGGCTGCAACTCCTGGAGCTGG - Intergenic
1189695148 X:43655384-43655406 TATGCTGGAGCTCCAGGAGGCGG - Intronic
1189775958 X:44470319-44470341 GAGGCTGGAAGTCCAGGATCAGG - Intergenic
1190255830 X:48761718-48761740 GCGCCTGGAGATCAAGGGGCAGG - Intergenic
1192214649 X:69150131-69150153 GGGGCTGCAGCTCCGGGGGCAGG + Intergenic
1192263429 X:69523058-69523080 GCGGCTGCAGCTCCAGCTGCTGG + Intronic
1192788137 X:74354401-74354423 GAGCCTGGGGCTGCAGGAGCTGG - Intergenic
1193743288 X:85244170-85244192 GCAGCTGTAGCTGCAGCAGCAGG + Exonic
1193900278 X:87167870-87167892 GTGGCTGGAGCTGGAGCAGCTGG + Intergenic
1194929397 X:99867812-99867834 ATGGCTGGAGCTGCAGCAGCTGG - Intergenic
1198313029 X:135438506-135438528 GCAGCTGGAGCTGCAGTAGAAGG + Intergenic
1198581777 X:138073568-138073590 GCGGGTGCAGCTCACGGAGCAGG + Intergenic
1200115555 X:153768308-153768330 GAGGCTGGACCTCCAGGGGCTGG - Exonic
1200783504 Y:7238134-7238156 GAGGCTGGAGGTCCAGGATGAGG - Intergenic
1200797135 Y:7351159-7351181 ATGCCTGGAGCCCCAGGAGCTGG - Intergenic
1202372795 Y:24209850-24209872 CCTGCTGGAGCTGCAGGGGCAGG - Intergenic
1202497987 Y:25460270-25460292 CCTGCTGGAGCTGCAGGGGCAGG + Intergenic