ID: 1027233033

View in Genome Browser
Species Human (GRCh38)
Location 7:76282896-76282918
Sequence CGACGGGGCGGGCGGCGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5223
Summary {0: 1, 1: 0, 2: 12, 3: 265, 4: 4945}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027233009_1027233033 20 Left 1027233009 7:76282853-76282875 CCCAAGAAGCCCCTCAGCCGGTG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG 0: 1
1: 0
2: 12
3: 265
4: 4945
1027233021_1027233033 -8 Left 1027233021 7:76282881-76282903 CCGCCCGGACCGGGCCGACGGGG 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG 0: 1
1: 0
2: 12
3: 265
4: 4945
1027233013_1027233033 9 Left 1027233013 7:76282864-76282886 CCTCAGCCGGTGAGTGCCCGCCC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG 0: 1
1: 0
2: 12
3: 265
4: 4945
1027233010_1027233033 19 Left 1027233010 7:76282854-76282876 CCAAGAAGCCCCTCAGCCGGTGA 0: 1
1: 0
2: 5
3: 16
4: 231
Right 1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG 0: 1
1: 0
2: 12
3: 265
4: 4945
1027233019_1027233033 -7 Left 1027233019 7:76282880-76282902 CCCGCCCGGACCGGGCCGACGGG 0: 1
1: 0
2: 0
3: 16
4: 114
Right 1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG 0: 1
1: 0
2: 12
3: 265
4: 4945
1027233015_1027233033 3 Left 1027233015 7:76282870-76282892 CCGGTGAGTGCCCGCCCGGACCG 0: 1
1: 0
2: 1
3: 3
4: 53
Right 1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG 0: 1
1: 0
2: 12
3: 265
4: 4945
1027233012_1027233033 10 Left 1027233012 7:76282863-76282885 CCCTCAGCCGGTGAGTGCCCGCC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG 0: 1
1: 0
2: 12
3: 265
4: 4945
1027233011_1027233033 11 Left 1027233011 7:76282862-76282884 CCCCTCAGCCGGTGAGTGCCCGC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG 0: 1
1: 0
2: 12
3: 265
4: 4945
1027233007_1027233033 26 Left 1027233007 7:76282847-76282869 CCGTCGCCCAAGAAGCCCCTCAG 0: 1
1: 0
2: 0
3: 15
4: 174
Right 1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG 0: 1
1: 0
2: 12
3: 265
4: 4945

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027233033 Original CRISPR CGACGGGGCGGGCGGCGGGG TGG Intronic
Too many off-targets to display for this crispr