ID: 1027235334

View in Genome Browser
Species Human (GRCh38)
Location 7:76294582-76294604
Sequence CAGTGGTGATGGGGGTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027235320_1027235334 5 Left 1027235320 7:76294554-76294576 CCACCTGGTCCCTCTGTGGCCCC No data
Right 1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG No data
1027235322_1027235334 -4 Left 1027235322 7:76294563-76294585 CCCTCTGTGGCCCCCGCTTCAGT No data
Right 1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG No data
1027235317_1027235334 9 Left 1027235317 7:76294550-76294572 CCTCCCACCTGGTCCCTCTGTGG No data
Right 1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG No data
1027235313_1027235334 16 Left 1027235313 7:76294543-76294565 CCCCAGCCCTCCCACCTGGTCCC No data
Right 1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG No data
1027235321_1027235334 2 Left 1027235321 7:76294557-76294579 CCTGGTCCCTCTGTGGCCCCCGC No data
Right 1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG No data
1027235316_1027235334 10 Left 1027235316 7:76294549-76294571 CCCTCCCACCTGGTCCCTCTGTG No data
Right 1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG No data
1027235315_1027235334 14 Left 1027235315 7:76294545-76294567 CCAGCCCTCCCACCTGGTCCCTC No data
Right 1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG No data
1027235323_1027235334 -5 Left 1027235323 7:76294564-76294586 CCTCTGTGGCCCCCGCTTCAGTG No data
Right 1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG No data
1027235314_1027235334 15 Left 1027235314 7:76294544-76294566 CCCAGCCCTCCCACCTGGTCCCT No data
Right 1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG No data
1027235319_1027235334 6 Left 1027235319 7:76294553-76294575 CCCACCTGGTCCCTCTGTGGCCC No data
Right 1027235334 7:76294582-76294604 CAGTGGTGATGGGGGTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027235334 Original CRISPR CAGTGGTGATGGGGGTGGCA TGG Intergenic
No off target data available for this crispr