ID: 1027237173

View in Genome Browser
Species Human (GRCh38)
Location 7:76304991-76305013
Sequence GGTCCACTGTGGTGTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027237173_1027237179 19 Left 1027237173 7:76304991-76305013 CCCCAAGGACACCACAGTGGACC No data
Right 1027237179 7:76305033-76305055 TGTCACCGCCACACTCCCTGAGG No data
1027237173_1027237182 25 Left 1027237173 7:76304991-76305013 CCCCAAGGACACCACAGTGGACC No data
Right 1027237182 7:76305039-76305061 CGCCACACTCCCTGAGGCCAGGG No data
1027237173_1027237181 24 Left 1027237173 7:76304991-76305013 CCCCAAGGACACCACAGTGGACC No data
Right 1027237181 7:76305038-76305060 CCGCCACACTCCCTGAGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027237173 Original CRISPR GGTCCACTGTGGTGTCCTTG GGG (reversed) Intergenic
No off target data available for this crispr