ID: 1027239080

View in Genome Browser
Species Human (GRCh38)
Location 7:76315538-76315560
Sequence CAGAACTGGCACATTTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027239074_1027239080 23 Left 1027239074 7:76315492-76315514 CCTCTGCTGCAGGGGGGTTGACC No data
Right 1027239080 7:76315538-76315560 CAGAACTGGCACATTTTAGGAGG No data
1027239076_1027239080 -7 Left 1027239076 7:76315522-76315544 CCACTCTGATCCTAATCAGAACT No data
Right 1027239080 7:76315538-76315560 CAGAACTGGCACATTTTAGGAGG No data
1027239075_1027239080 2 Left 1027239075 7:76315513-76315535 CCACTGTTTCCACTCTGATCCTA No data
Right 1027239080 7:76315538-76315560 CAGAACTGGCACATTTTAGGAGG No data
1027239073_1027239080 24 Left 1027239073 7:76315491-76315513 CCCTCTGCTGCAGGGGGGTTGAC No data
Right 1027239080 7:76315538-76315560 CAGAACTGGCACATTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027239080 Original CRISPR CAGAACTGGCACATTTTAGG AGG Intergenic
No off target data available for this crispr