ID: 1027244160

View in Genome Browser
Species Human (GRCh38)
Location 7:76354766-76354788
Sequence CTCGTTTTCAGCCCTAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027244160 Original CRISPR CTCGTTTTCAGCCCTAAGGC TGG (reversed) Intronic
901954036 1:12771114-12771136 AGCCTTTTCAGCTCTAAGGCTGG - Intergenic
901956305 1:12788165-12788187 ATCTTTATCAGCTCTAAGGCTGG + Intergenic
901979683 1:13024220-13024242 ATCCTTATCAGCTCTAAGGCTGG + Intronic
902021629 1:13350482-13350504 ATCCTTATCAGCTCTAAGGCTGG - Intergenic
906293766 1:44636603-44636625 CTCCTCTTCAGCCCTATGTCAGG + Intronic
907429055 1:54400589-54400611 CTCTTTTTCAGCCCTGAAGAGGG + Intronic
912733983 1:112133812-112133834 CTTGTTTTCAGCCTTCAGCCTGG - Intergenic
912771515 1:112468111-112468133 CTCATTTGCAGCCATAAGGATGG - Intronic
916674093 1:167051968-167051990 CTCCTTTTCTTCCCTAAGCCTGG + Intergenic
917239826 1:172936221-172936243 CGGGTTTCCAGCCCAAAGGCCGG + Intergenic
1071472710 10:85995387-85995409 CTCTTCCTCACCCCTAAGGCTGG - Intronic
1075162571 10:120037486-120037508 CTCATTTTCTGCCTTAAAGCAGG - Intergenic
1079134902 11:17770820-17770842 CTCCTTTCCAGCCCTAGGGTAGG - Intronic
1085013237 11:73155942-73155964 TTCATTATCATCCCTAAGGCTGG + Intergenic
1087335505 11:96839470-96839492 CTCTGTTTTAGCCATAAGGCAGG - Intergenic
1089844585 11:121448544-121448566 CTCGTTTTCTCCCCCAAAGCAGG - Intergenic
1104613812 12:130252442-130252464 CTCATTTTCAGCCCTAGAGGAGG + Intergenic
1113853871 13:113433442-113433464 CCTGTTTTCAGCCCAAAAGCAGG - Intronic
1114550636 14:23530997-23531019 GAGGTCTTCAGCCCTAAGGCTGG - Intronic
1124836264 15:33198711-33198733 CTCCTTATCTGCCCCAAGGCAGG + Intergenic
1127962732 15:63901848-63901870 CTCTTTTTCCTCCCTAGGGCAGG + Intergenic
1135503291 16:23015430-23015452 CTACTTTTCTGCCCTCAGGCAGG - Intergenic
1139511016 16:67428634-67428656 CTGGTTTTCTGCCCCTAGGCAGG + Intergenic
1143021089 17:3917524-3917546 CTCCTTATCAGCCTTAAGGGTGG - Intergenic
1145956564 17:28858782-28858804 CATGTTGTCAGCCCTAAGCCAGG + Exonic
1150627144 17:66849017-66849039 CTTGTTGTCAGCCCTAGAGCCGG + Intronic
1152153501 17:78617665-78617687 GTCCTTTTCAGGCCTAAGCCAGG - Intergenic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1161847910 19:6722767-6722789 CCAGTTTTCACCCATAAGGCTGG - Intronic
1164390453 19:27815166-27815188 CTCACCTCCAGCCCTAAGGCTGG - Intergenic
1167537998 19:50067673-50067695 CTCATTTTCACCCTTCAGGCAGG + Intergenic
925007520 2:455506-455528 CTCTTTTTCAGTCCTAACCCTGG - Intergenic
925318484 2:2942700-2942722 CTCCCTTTCAGCCCTGAGACTGG - Intergenic
925894501 2:8460949-8460971 CTAGTTCTCAGCCCTATGCCTGG - Intergenic
929993799 2:46812304-46812326 CTTCTTTTCACCCCTAAGGAGGG + Intergenic
931052480 2:58429083-58429105 CAGGTTCTCAACCCTAAGGCCGG - Intergenic
940770598 2:157835720-157835742 CTGGTTTTCAGCCCTACTGTGGG - Intronic
941261726 2:163306325-163306347 CTCAATTTCAGCCCTAAAGCAGG - Intergenic
944188265 2:196973570-196973592 CTCCTTTTCATCCCTAACCCTGG + Intronic
1169189531 20:3649143-3649165 CCCTTTTTCTGCCCTGAGGCCGG - Exonic
1173600389 20:44290832-44290854 CTCTTCTTCAGCCCCAAAGCTGG - Intergenic
1175122260 20:56724787-56724809 CTCCTCTTCAACCCTAAGCCAGG - Intergenic
1178732269 21:35115641-35115663 TTCGTTTTCAGTCCAAAGACAGG + Intronic
1184840923 22:47052030-47052052 CTCCTCTTCAGCGGTAAGGCAGG + Intronic
1185122586 22:48981240-48981262 CTAGGTTTCTGCACTAAGGCAGG + Intergenic
954707757 3:52490064-52490086 CTCGTTTTCAACCTGAAGACGGG - Exonic
957698041 3:83669354-83669376 CACATTTTTACCCCTAAGGCTGG - Intergenic
962108267 3:132416216-132416238 GTCTTTTTCCGCCCTAAGGTAGG + Intergenic
970159242 4:13172410-13172432 CACGTGTTCAGGCCTATGGCAGG - Intergenic
970163798 4:13215210-13215232 CTCTTTTGCAGTCCTAAGGGAGG + Intergenic
983638083 4:169918214-169918236 CTGGTTTAAAGCCCTAAGGGTGG + Intergenic
984891922 4:184501964-184501986 CTCGTTTTCTCCCCTGAGTCTGG - Intergenic
985731125 5:1549610-1549632 CATGTTTTCAGCCCCAACGCAGG + Intergenic
991674293 5:69076025-69076047 CTCTCTTCCAGCCCTGAGGCTGG - Intergenic
992170124 5:74093220-74093242 CTCCTTTCCAGCCCAAAGTCAGG + Intergenic
995041318 5:107591334-107591356 CTGGTGTTCAGCTCTATGGCTGG - Intronic
998008687 5:138675533-138675555 TTCACTCTCAGCCCTAAGGCTGG - Intronic
1001170088 5:169410972-169410994 CTTGTTTTCAGGCCTAGGGAGGG + Intergenic
1004890596 6:20097020-20097042 CTCATTTTCAGGCCTAAGAAGGG + Intergenic
1011047329 6:83099030-83099052 CTCCTTTTTCTCCCTAAGGCAGG - Intronic
1012976797 6:105788528-105788550 CTCTTTTTGAGCCTTAAGGAAGG + Intergenic
1014995848 6:128143460-128143482 CTCATTTTCAGACTTAATGCAGG - Intronic
1018171951 6:161150674-161150696 CCCGCCTTCAGCCCCAAGGCGGG - Intronic
1024740915 7:52353542-52353564 CTCGTTCTCATCCCCCAGGCTGG + Intergenic
1027244160 7:76354766-76354788 CTCGTTTTCAGCCCTAAGGCTGG - Intronic
1032274375 7:130441230-130441252 CTCTCTTCCCGCCCTAAGGCTGG - Exonic
1038729408 8:30113720-30113742 ATCGTTTTCATCCGTAATGCTGG + Intronic
1039918517 8:41876633-41876655 CTGGTTTCCAGCCTGAAGGCTGG + Intronic
1041927344 8:63250344-63250366 CTGGTCTACAGTCCTAAGGCAGG - Intergenic
1055405032 9:75965465-75965487 CTGGTCTTCTGCCCTAGGGCTGG - Intronic
1057446567 9:95119956-95119978 CTCGTTGGGAGCCCCAAGGCAGG - Intronic
1062483295 9:136762364-136762386 CTTGCTGTCAGCCCTCAGGCTGG - Intronic
1185705564 X:2263869-2263891 ATCGTTTTTATCCTTAAGGCGGG + Intronic
1186472091 X:9829550-9829572 TTCCTTTTCAGCCCTTAGGGTGG + Intronic
1189246366 X:39566507-39566529 ATTGTTGTCTGCCCTAAGGCAGG + Intergenic
1195211583 X:102655658-102655680 CTGGTTTTCAGCCCAAAACCAGG - Exonic