ID: 1027244783

View in Genome Browser
Species Human (GRCh38)
Location 7:76359394-76359416
Sequence CGCAGGCGCAGGAGGACGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027244772_1027244783 25 Left 1027244772 7:76359346-76359368 CCAAGGACAAAGGGGCGGTCAAG No data
Right 1027244783 7:76359394-76359416 CGCAGGCGCAGGAGGACGGGGGG No data
1027244776_1027244783 -8 Left 1027244776 7:76359379-76359401 CCAGCGGACATAGCGCGCAGGCG No data
Right 1027244783 7:76359394-76359416 CGCAGGCGCAGGAGGACGGGGGG No data
1027244775_1027244783 -7 Left 1027244775 7:76359378-76359400 CCCAGCGGACATAGCGCGCAGGC No data
Right 1027244783 7:76359394-76359416 CGCAGGCGCAGGAGGACGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027244783 Original CRISPR CGCAGGCGCAGGAGGACGGG GGG Intergenic
No off target data available for this crispr