ID: 1027250354

View in Genome Browser
Species Human (GRCh38)
Location 7:76395087-76395109
Sequence AATTATGAGCAGACGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027250354_1027250356 3 Left 1027250354 7:76395087-76395109 CCTTGCTCCGTCTGCTCATAATT 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1027250356 7:76395113-76395135 TCACCCACCTCTGCACCATCTGG 0: 1
1: 0
2: 1
3: 17
4: 201
1027250354_1027250364 29 Left 1027250354 7:76395087-76395109 CCTTGCTCCGTCTGCTCATAATT 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1027250364 7:76395139-76395161 AAGCCCTGGCCTGTTAGCCAGGG 0: 1
1: 0
2: 2
3: 7
4: 156
1027250354_1027250363 28 Left 1027250354 7:76395087-76395109 CCTTGCTCCGTCTGCTCATAATT 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1027250363 7:76395138-76395160 AAAGCCCTGGCCTGTTAGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 157
1027250354_1027250360 15 Left 1027250354 7:76395087-76395109 CCTTGCTCCGTCTGCTCATAATT 0: 1
1: 0
2: 0
3: 10
4: 98
Right 1027250360 7:76395125-76395147 GCACCATCTGGCCAAAGCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027250354 Original CRISPR AATTATGAGCAGACGGAGCA AGG (reversed) Intronic
915577684 1:156791329-156791351 TCTTATGAGCAGGAGGAGCAGGG + Intronic
917765636 1:178213595-178213617 AATGATGAGCATAAGAAGCAAGG + Intronic
918581216 1:186132278-186132300 AAATATGAGCCTACAGAGCAGGG - Intronic
921899994 1:220439822-220439844 AATCAAGAGCAGGCTGAGCATGG - Intergenic
924019007 1:239760742-239760764 AATTATGAACAGAGGCATCAAGG - Intronic
924055053 1:240116835-240116857 AAATTAGAGCAGACTGAGCAAGG + Intronic
924503396 1:244657715-244657737 AATTATGAGAGGACGAACCAAGG - Intronic
1062973101 10:1663423-1663445 AGGGATGAGCAGGCGGAGCACGG - Intronic
1064571015 10:16693241-16693263 AATAATGGCCAGCCGGAGCATGG - Intronic
1073160978 10:101394673-101394695 AATTCTTAGCAGTCGGGGCAGGG + Intronic
1078269463 11:9781460-9781482 AATGATGTGCAGACAGAGCCAGG + Intronic
1081041136 11:38214951-38214973 ATTTATAATCAGACAGAGCAGGG + Intergenic
1084740835 11:71138489-71138511 AATAATAAGCAGACGGGCCAAGG + Intronic
1089473520 11:118739863-118739885 AAGTATGAGGACATGGAGCAGGG + Intergenic
1091303905 11:134524423-134524445 AATTAAGAGCAGTCCGTGCAGGG - Intergenic
1100659118 12:96677895-96677917 CATTATGAGCCCAGGGAGCAGGG - Intronic
1101341157 12:103842180-103842202 AATTTTGAGCAGGTGGAGTAGGG + Intronic
1106714017 13:32369143-32369165 AATACTGAGCAGACGCAGCCAGG - Intronic
1109889655 13:68592425-68592447 AATAATGAGAAAACGGAGCATGG + Intergenic
1110296527 13:73872708-73872730 TTTTAAGAGCAGATGGAGCAAGG - Intronic
1112143477 13:96672084-96672106 AATTAATAGCAGTCTGAGCATGG - Intronic
1116143079 14:41025623-41025645 AATGATGAGCAGGCTGAGCATGG - Intergenic
1116144589 14:41048125-41048147 ATTTCTGAGAAGACGGAGTAAGG - Intergenic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1122163903 14:99806699-99806721 AAGTATGAGGAGACAGGGCATGG + Intronic
1125403253 15:39326752-39326774 AGTTATGAGCAGATGGAGGGAGG - Intergenic
1125479259 15:40069339-40069361 GATTACGACCAGACGGAGCCAGG + Intergenic
1127300709 15:57650983-57651005 AATTATGAGCAGAGTGATGAAGG - Intronic
1127893623 15:63276736-63276758 GACTGTGAGAAGACGGAGCAGGG + Intronic
1131175898 15:90209678-90209700 AATGATGGGCATACGGAGAAGGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1138107590 16:54297539-54297561 AAATATCAGCAGAAGTAGCATGG - Intergenic
1139184942 16:64794934-64794956 AATTATGAGAAGATGGATAATGG + Intergenic
1139243021 16:65413272-65413294 AATGAGGCGCAGACGGAGCATGG + Intergenic
1149103051 17:52928834-52928856 AATTAGGAGGAGAAGGAGGATGG + Intergenic
1149429619 17:56587270-56587292 AATGGTGAGGAGACGGAGTAGGG + Intergenic
1151490803 17:74431464-74431486 AATTAGGACAAGTCGGAGCAGGG + Exonic
1151863194 17:76781572-76781594 CATTATGAGCAAACAGAGCAAGG - Intergenic
1152584898 17:81184610-81184632 TATTATGAGCAAACAAAGCAGGG + Intergenic
1153455355 18:5275403-5275425 AATTATGAGAAGAAAGAGAAGGG + Intergenic
1153753986 18:8261750-8261772 AATTATCATCAGCGGGAGCATGG - Intronic
1157190075 18:45574246-45574268 AGTTATGGGGAGAAGGAGCATGG + Intronic
1164166719 19:22684599-22684621 AACTATGAACAGGCTGAGCATGG - Intergenic
1164844143 19:31417640-31417662 AACTTTGAGGAGACGGAGCCTGG - Intergenic
1165670937 19:37678454-37678476 AATTAGGAGGAGAGGGTGCATGG + Intronic
1167633258 19:50638930-50638952 AATTAGGAACAGACAGACCAGGG + Intronic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
929980025 2:46669477-46669499 GATTATGAGCTGCTGGAGCAAGG + Intergenic
930983373 2:57555062-57555084 AATTATGAGCAGGCCGGGCTTGG - Intergenic
931825655 2:65997926-65997948 AATTTAGGGCAGACGGAGGAGGG - Intergenic
938180270 2:129176125-129176147 AATAAAGAGGAGACTGAGCAAGG - Intergenic
940726076 2:157338022-157338044 AAGTCTGTGCAGAAGGAGCATGG - Intergenic
942122687 2:172793843-172793865 AAATATGAACAGACTGGGCATGG + Intronic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
1171245185 20:23605045-23605067 CATTAAGTGCAGACAGAGCAAGG + Intronic
1177850737 21:26345140-26345162 AATTCTGAGCAGTTGGAGCAGGG - Intergenic
1185063200 22:48617785-48617807 TGTTCTGAGAAGACGGAGCAGGG + Intronic
950015020 3:9749383-9749405 AAGCATGAGCAGATGGAGTATGG + Intergenic
952385149 3:32835657-32835679 AATTATGAGCTGACCAAGGATGG - Intronic
952586442 3:34898556-34898578 AATTATGAGCACATGGAGATTGG - Intergenic
953696173 3:45161412-45161434 CACTATGAGAAGAGGGAGCAAGG - Intergenic
956302736 3:67790247-67790269 AATTCTCAGGAGAAGGAGCAGGG - Intergenic
962105752 3:132387040-132387062 AATTCTGAGCAAATGGTGCATGG - Intergenic
967119803 3:186372895-186372917 GATTATGAGGAGAAGCAGCAAGG - Intergenic
967293010 3:187940076-187940098 AAAAATGAGCAGACTGAGAAGGG + Intergenic
968359249 3:198135501-198135523 ATATATGAGCAGGCAGAGCATGG - Intergenic
969893266 4:10279345-10279367 AAGTATGTGGAGAGGGAGCAAGG + Intergenic
979550682 4:121987732-121987754 CATTATGAGGAGACCAAGCATGG - Intergenic
980839379 4:138238891-138238913 AATTATTCCCAGACTGAGCATGG - Intronic
982641578 4:157968564-157968586 AAATATGAGATGACAGAGCAGGG - Intergenic
986056219 5:4139483-4139505 AATTGTCAGAAGACTGAGCATGG + Intergenic
987106677 5:14646471-14646493 AACGATGAGGAGACTGAGCAGGG - Intergenic
988709421 5:33758612-33758634 AATTCTGAGCAGAAGGAGGAAGG + Intronic
990921005 5:60966788-60966810 AATCTTGAGCAGAAGGAACAAGG - Intronic
993738199 5:91503076-91503098 AACTATGAGGAGAGGAAGCAGGG + Intergenic
994141759 5:96348914-96348936 AATTATGAGCAGAAAGTGCAAGG + Intergenic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
999878816 5:155838376-155838398 AATTATGAGAAAACAGAGCAGGG - Intergenic
1002172404 5:177382795-177382817 AAGCCTGAGCAGACGGAGCTTGG + Intronic
1007328692 6:41085643-41085665 ATTTATGAGCAGTGGGATCATGG - Intronic
1014467089 6:121769383-121769405 AATTGTGAGCATATGGAGCATGG + Intergenic
1020603942 7:10311242-10311264 AAGTATGAACAGACGGGGCAAGG + Intergenic
1023693270 7:42815942-42815964 AATTATGAGCAAAAAGAACAAGG + Intergenic
1025115511 7:56254763-56254785 ACTTATGAACAGAAGGAGGACGG - Intergenic
1027250354 7:76395087-76395109 AATTATGAGCAGACGGAGCAAGG - Intronic
1027868622 7:83677834-83677856 AATTATGAGCTGTGTGAGCATGG - Intergenic
1031267897 7:119605606-119605628 AAATATGAGCAGACAAATCAGGG + Intergenic
1033618761 7:143042715-143042737 AATTGTGAGCAGAAGGAGGGAGG - Intergenic
1034577345 7:152011791-152011813 AATTCTGAGCAGATGGGCCAAGG - Intronic
1037310017 8:17545358-17545380 AAATATAAGGAGACAGAGCAGGG - Intronic
1037483782 8:19328696-19328718 ATTTCTGAGCAGATGGTGCAAGG - Intronic
1037849284 8:22313178-22313200 AAAGATGAACAGACAGAGCAAGG - Intronic
1037861460 8:22408454-22408476 GAGAATGAGCAGACGGAGGAGGG + Exonic
1041212122 8:55562979-55563001 GCTTATGAGCAGACTGAACATGG - Intergenic
1044069052 8:87733324-87733346 AACTCTCAGCAGAAGGAGCAAGG - Intergenic
1047792419 8:128217813-128217835 AATCGTGAGCAGACGGATGAAGG - Intergenic
1051545376 9:18268479-18268501 ATTTAGGAGAAGAAGGAGCAGGG + Intergenic
1052304676 9:26993758-26993780 AAATATGAGCTGATGGAGCTGGG - Exonic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058951766 9:109910655-109910677 GACTAGGAGCAGACGCAGCAGGG + Intronic
1058951786 9:109910776-109910798 GACTAGGAGCAGACGCAGCAGGG + Intronic
1059310119 9:113382655-113382677 AATTTTGAGCAAAAGAAGCAAGG - Intergenic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1059787520 9:117601899-117601921 AATTATGAGCAAAAAGAACAAGG + Intergenic
1060454032 9:123773121-123773143 AAATAAGAGCAGAGGGGGCAGGG + Intronic
1187762883 X:22607302-22607324 AATTATCATCAGACTGAACAGGG + Intergenic
1188380190 X:29482124-29482146 AATGATGAGTAGAAGGAACATGG - Intronic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1192866546 X:75139176-75139198 AATTTTGAGCAGAGGGAATAAGG - Intronic