ID: 1027250786

View in Genome Browser
Species Human (GRCh38)
Location 7:76397590-76397612
Sequence CGAAGGCGGCGAGCCCCGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027250786_1027250790 8 Left 1027250786 7:76397590-76397612 CCAGGCGGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1027250790 7:76397621-76397643 GTTGTCCAGCAGGATGTGTCCGG 0: 1
1: 0
2: 3
3: 11
4: 120
1027250786_1027250789 -2 Left 1027250786 7:76397590-76397612 CCAGGCGGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1027250789 7:76397611-76397633 CGCAGTGCACGTTGTCCAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 72
1027250786_1027250792 26 Left 1027250786 7:76397590-76397612 CCAGGCGGGGCTCGCCGCCTTCG 0: 1
1: 0
2: 1
3: 5
4: 82
Right 1027250792 7:76397639-76397661 TCCGGTGCCATAGCCGAAGAAGG 0: 1
1: 0
2: 0
3: 2
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027250786 Original CRISPR CGAAGGCGGCGAGCCCCGCC TGG (reversed) Exonic