ID: 1027251038

View in Genome Browser
Species Human (GRCh38)
Location 7:76398857-76398879
Sequence GTGTTTAAGGGGCAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 468}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027251031_1027251038 -9 Left 1027251031 7:76398843-76398865 CCTCACACCACGGGGTGTTTAAG 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG 0: 1
1: 0
2: 4
3: 38
4: 468
1027251030_1027251038 -5 Left 1027251030 7:76398839-76398861 CCATCCTCACACCACGGGGTGTT 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG 0: 1
1: 0
2: 4
3: 38
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027251038 Original CRISPR GTGTTTAAGGGGCAGGAGGA TGG Intronic
902065513 1:13682424-13682446 ATATTTAAGGGGAAGTAGGATGG + Intergenic
902480465 1:16708761-16708783 GTCTTCAAGAGGGAGGAGGATGG - Intergenic
902682317 1:18052077-18052099 GTGTGTTAGGGGAAGGAGTAGGG - Intergenic
903169011 1:21540692-21540714 GTGTTTAAAGGCAAGGAGGCAGG - Intronic
903210540 1:21815780-21815802 GTGTTTCATGGGGAGGAGGGTGG - Intronic
903335416 1:22621246-22621268 ATGTTTATGGAGCAGGAAGAGGG - Intergenic
904806435 1:33135610-33135632 ATGTTTGAGGGACAGGAGGCTGG - Intergenic
904910747 1:33932376-33932398 GTATTTAAGGGGAATGAGGGTGG + Intronic
905002899 1:34687186-34687208 GAATGGAAGGGGCAGGAGGAAGG - Intergenic
906306598 1:44723925-44723947 GGGCTGAAGGGGGAGGAGGAAGG - Intronic
906383619 1:45348371-45348393 GTGTTTCTGAGGAAGGAGGAAGG - Intronic
906716822 1:47976253-47976275 GTGTGTAAGGGGTAGAAGGTTGG - Intronic
906782537 1:48585484-48585506 GTGTGTATGGGGCATGAAGAGGG + Intronic
907760475 1:57353746-57353768 GTGTGGAAGGGGGAGGAGCAGGG - Intronic
908528424 1:65010339-65010361 GTGTTCTGAGGGCAGGAGGATGG - Intergenic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909752889 1:79185791-79185813 GTCTTAAAGGGGAAAGAGGAGGG - Intergenic
910981753 1:92965199-92965221 GTGGTTAAGGGGTAGGACCACGG - Intergenic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
912092657 1:106100417-106100439 GTGTTGGAGGGGCAGGGGCAGGG - Intergenic
912202728 1:107476732-107476754 GTGTTTAAAGGAGAAGAGGAAGG - Intronic
912410595 1:109478305-109478327 GTGTAGAACAGGCAGGAGGAGGG - Intronic
912583761 1:110743169-110743191 GTATTTCAAGGGCAGGAGGGTGG - Intergenic
912775285 1:112502745-112502767 GTTTTTCAGGAACAGGAGGACGG + Intronic
912867049 1:113266987-113267009 GTGTTGGAGGAGCAGCAGGAAGG - Intergenic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
915840687 1:159210455-159210477 ATGTTTACGGGATAGGAGGAGGG + Intergenic
916051885 1:161042174-161042196 GTGTCTGAGGGGCAGCTGGATGG - Exonic
919749538 1:201028352-201028374 GTGTTTACAGGGGAGGAGGGAGG + Intergenic
922616076 1:226961899-226961921 GTCCTCATGGGGCAGGAGGAGGG + Intronic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
922976615 1:229789845-229789867 CTGTTTGCAGGGCAGGAGGAGGG + Intergenic
923043854 1:230339823-230339845 GTGGTTACGGGGCTGGGGGATGG + Intronic
1063219590 10:3954371-3954393 GTGGGTAGGGGGCAGGGGGAGGG + Intergenic
1063755126 10:8998654-8998676 GTTTTTAAGTAGGAGGAGGATGG + Intergenic
1063926852 10:10986906-10986928 GACTTTCAGTGGCAGGAGGAAGG + Intergenic
1064000831 10:11662607-11662629 GTGTGTTGGGGGCAGGAGGGAGG - Intergenic
1065512836 10:26496324-26496346 GTGGATTAGGGTCAGGAGGAGGG - Exonic
1065898868 10:30187549-30187571 GTGCTTAAGGGACAGCAGGGTGG + Intergenic
1067317557 10:45182259-45182281 CTGTTGTGGGGGCAGGAGGAGGG + Intergenic
1067400540 10:45969683-45969705 GTGTTTAAAGAGTATGAGGAAGG - Intergenic
1067437280 10:46287129-46287151 CTGGTGAAAGGGCAGGAGGAGGG + Exonic
1067748745 10:48956320-48956342 AGGTTCAAGGGGCAGGAGGCTGG - Intronic
1067868882 10:49939240-49939262 GTGTTTAAAGGGTATGAGGAAGG - Intronic
1070617223 10:77978382-77978404 GTGCTGAAGGACCAGGAGGAGGG + Intronic
1070871488 10:79757796-79757818 TTGTTTCAGGGGAAGGAGGGAGG + Intergenic
1071827790 10:89342429-89342451 TTGTTTAAGGAGCAGGAGGATGG - Intronic
1071996904 10:91158420-91158442 GATTTGAAGGGGGAGGAGGAAGG + Intergenic
1072195782 10:93116262-93116284 GTCTTTGAGGGGCACAAGGAGGG - Intergenic
1072326835 10:94307104-94307126 GGGTTTCAGGTGCAGGAAGAGGG + Intronic
1072563799 10:96600790-96600812 GTGTTAATGGGGCATAAGGAAGG - Intronic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073306755 10:102508945-102508967 GTCTTTCAGGGGTAGGAGAAGGG + Intronic
1073483370 10:103800990-103801012 GTGGTGAAGAGGCGGGAGGATGG - Intronic
1074261497 10:111858042-111858064 CTGTTCTGGGGGCAGGAGGAGGG - Intergenic
1074559455 10:114522080-114522102 GTGCTTGAGGGGCAGAAAGAAGG + Intronic
1075198344 10:120380184-120380206 CGGTTTGAGGGGCAAGAGGAGGG + Intergenic
1075944445 10:126420034-126420056 GTGTTGAGGGGGTGGGAGGAGGG + Intergenic
1075993837 10:126860439-126860461 TTGTTTAATGGTCAAGAGGAAGG - Intergenic
1078120853 11:8507537-8507559 GTGGTAAAGGTGAAGGAGGAAGG + Intronic
1078264999 11:9748645-9748667 GTGCTGAAGGGACACGAGGAGGG - Intronic
1078397894 11:10998091-10998113 GTGTTTACCTGGGAGGAGGAAGG - Intergenic
1079340181 11:19605256-19605278 GGGTTGAAGGGGCAGCTGGATGG - Intronic
1079586690 11:22133995-22134017 GTGGTTAGAGGGTAGGAGGAGGG + Intergenic
1080104721 11:28499978-28500000 TTGTTTAAAGGGCAGGTGGTTGG + Intergenic
1080394222 11:31875128-31875150 GGGTTTCTGGGGCTGGAGGAAGG - Intronic
1080908035 11:36566505-36566527 GATTTTAAGGAGCAGGAGGATGG + Intronic
1083254812 11:61489578-61489600 GTGTTTCAGCGTCAGGTGGAGGG + Intronic
1083261482 11:61525423-61525445 GTGTTGAAGGGCCAGGAAGGAGG - Intronic
1083455968 11:62778787-62778809 GTGGTTGAGGGGGAGGAGGCTGG + Intronic
1084005906 11:66323392-66323414 GGGTTTAAGGGGCTGGAGAGGGG + Intergenic
1084180348 11:67442906-67442928 GTGTGTCGGGGGCAGGAGGTGGG + Intronic
1084294108 11:68199329-68199351 GTGTTTCAGGTGGAGAAGGAGGG + Intronic
1084304296 11:68271764-68271786 GAGGTTGGGGGGCAGGAGGAGGG - Intronic
1084490916 11:69477801-69477823 CTTTTTAAGGGGCAGGATGTGGG + Intergenic
1084804462 11:71569375-71569397 GTGCTTTAGGGCCAGGAGGGAGG - Intergenic
1084805993 11:71579253-71579275 GTGCTTTAGGGCCAGGAGGGAGG + Intergenic
1084859528 11:72009217-72009239 GAGGTTGAAGGGCAGGAGGAAGG + Intronic
1084867976 11:72075418-72075440 GCCTTTGAGGGGCAGGAGGCTGG - Intronic
1085473172 11:76771207-76771229 GGGTGGAAGGGGCAGGAGGAGGG - Intergenic
1085512719 11:77096396-77096418 GGATTAAAGGGGCCGGAGGAAGG + Intronic
1085783339 11:79429331-79429353 GTGTTTATTGGGGAGGAGGCGGG - Intronic
1086778473 11:90870992-90871014 GTGTGTTAGGGGTATGAGGAGGG + Intergenic
1089399550 11:118156560-118156582 GGGTTTATGGGGGAAGAGGAGGG - Intergenic
1089419400 11:118319859-118319881 GTGTTTAAGGAGCAGGGAGGAGG - Intergenic
1089612281 11:119676233-119676255 GCCTTTGAGGGTCAGGAGGAAGG - Intronic
1090446515 11:126769178-126769200 GTGTTGAAAGCGTAGGAGGAAGG - Intronic
1090678432 11:129027506-129027528 TTGGTAAAGGGTCAGGAGGAAGG - Intronic
1092003910 12:5052919-5052941 GGGTTCATGGGGCAGGAGGGTGG - Intergenic
1092189703 12:6510134-6510156 GTGTTTATGGGTCAGGGGGTAGG + Intronic
1092217782 12:6694909-6694931 GTGTGCAAGGGGCAGGAGCCAGG + Exonic
1095184357 12:39184689-39184711 GTGTTGAGGGGGATGGAGGATGG - Intergenic
1095985549 12:47997303-47997325 GGGTGTAAGGGATAGGAGGAAGG - Intronic
1096846536 12:54410228-54410250 GTGGAGCAGGGGCAGGAGGATGG + Intronic
1097040467 12:56153214-56153236 TTGTTTTAGGGGCAGGAGTGGGG - Intronic
1097085781 12:56467248-56467270 TTTTTTGAGGGGTAGGAGGATGG + Intronic
1098076282 12:66735595-66735617 AAGTTTAAGTGGCAGCAGGAGGG + Intronic
1098599838 12:72317881-72317903 GGGCTGAAGGGGCAGGAGGAAGG + Intronic
1098636889 12:72795496-72795518 GGGGTTAGGGGGCAAGAGGAGGG - Intergenic
1099196604 12:79624276-79624298 TAGTTGAGGGGGCAGGAGGAGGG - Intronic
1101172062 12:102107893-102107915 GCCTTTAAGGGGAAGGAAGAAGG + Intronic
1104182899 12:126399502-126399524 GTGTTTAAGGAAGAGGAGAAAGG - Intergenic
1104779818 12:131412928-131412950 GTGTGTTGGGGGCAGGATGAGGG + Intergenic
1104917841 12:132275202-132275224 ATGTTTTATGGGAAGGAGGAGGG - Intronic
1105596298 13:21842546-21842568 GTGGTTAGGGGGAAGGGGGATGG + Intergenic
1106019742 13:25903310-25903332 GTGGTGGAGGGGCAGCAGGAAGG - Intronic
1106229930 13:27813956-27813978 GTGTGTCAGGGGCAGGAGGGTGG - Intergenic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1107062930 13:36180275-36180297 GTGGTGAAGGGGGAGGAGGCTGG - Intronic
1107556143 13:41518089-41518111 GTGTGTAGGGGGCAGGAGAGAGG + Intergenic
1108488107 13:50948537-50948559 GTCTTTGAGGGGCAGAAGAAGGG + Intronic
1108668492 13:52655981-52656003 GTTTTTAAGAGGCAGCAGAATGG + Intronic
1110360372 13:74617911-74617933 ATGTTTAAGGGACAGCAGAAAGG + Intergenic
1110383279 13:74878711-74878733 GTATTAAAGGGGCAGCAGGAAGG - Intergenic
1111152255 13:84269741-84269763 GTGTTGAAGGGACAGGAAGGAGG - Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112565250 13:100546850-100546872 GTGGTTTAGAGGCATGAGGATGG - Intronic
1112760991 13:102692946-102692968 CTGGTTTAGAGGCAGGAGGAAGG + Intronic
1113521710 13:110946379-110946401 ATGTGTCCGGGGCAGGAGGACGG + Intergenic
1114320522 14:21543612-21543634 GTGTTTTAGGGGAAGAGGGAGGG + Intergenic
1116153619 14:41174496-41174518 CTGTTTAAGGTGCAAGAAGAGGG - Intergenic
1117321441 14:54627687-54627709 GGTTTAAAGGAGCAGGAGGAGGG - Intronic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1118738458 14:68719979-68720001 GTGACTCAGAGGCAGGAGGAGGG - Intronic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1119847787 14:77843450-77843472 GTGATTAAGGGGCAGATGGAGGG + Intronic
1119852315 14:77874901-77874923 ATGGTTAAGGGACAGGTGGATGG + Intronic
1119933151 14:78567138-78567160 GTCTTGAAGGGGCTGCAGGATGG + Intronic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1120722681 14:87905489-87905511 GTGGTGCTGGGGCAGGAGGATGG + Intronic
1120855538 14:89208873-89208895 ATGTTTAAGAGACAGGTGGAGGG - Intronic
1120875037 14:89367824-89367846 GGGTTTCTGGGGCAGGAGGCCGG - Intronic
1121225362 14:92317918-92317940 GTGTTTAAAGGGCAGAAGACTGG + Intergenic
1121259659 14:92557033-92557055 GTGGTTACGGGGCTGCAGGAGGG - Intronic
1122100561 14:99406114-99406136 GTATTTAAGGGGCAAAAGCAAGG - Intronic
1123192055 14:106580873-106580895 CTGATTAAGGGGCCTGAGGATGG - Intergenic
1123976618 15:25559850-25559872 GTGATTCAGGGGAAGGAGCACGG - Intergenic
1124138099 15:27052558-27052580 GTGTTTTAGAAGCAGCAGGAGGG - Intronic
1127327281 15:57907968-57907990 TTGTTTATGGGGTAAGAGGATGG + Intergenic
1128085109 15:64880801-64880823 GTCTTGAGGGGACAGGAGGAGGG - Intronic
1128233324 15:66050488-66050510 ATGTGCAAGGGGCAGGAGGGAGG + Intronic
1128358341 15:66943679-66943701 GTGTGTCAGGGGCAGGGGCAGGG + Intergenic
1128868835 15:71136845-71136867 GTGTGTAAGGGGCGGCAGAATGG + Intronic
1129962256 15:79697874-79697896 GTGTTTAAGGGGCTTAAGGTGGG - Intergenic
1130152050 15:81318651-81318673 GAGTGTAAGGGGCAGTAGGGTGG - Intronic
1130823106 15:87515957-87515979 GTGGTTACGAGGCAGGAGAATGG + Intergenic
1131053882 15:89364396-89364418 GTGGTTAAGTGGCAGGAGAGGGG - Intergenic
1131822404 15:96286154-96286176 GTGTTGAAAGGGCAGGAACAAGG + Intergenic
1132357755 15:101185431-101185453 GTGTTCACAGGGAAGGAGGATGG - Intronic
1133527324 16:6618137-6618159 GTGTTACAGGGACATGAGGAGGG + Intronic
1134013763 16:10874291-10874313 GTCTTTAAGAGGCAGGAACAAGG + Intergenic
1134594407 16:15484306-15484328 GTGGTCAAGAGGCAGGAGAAGGG - Intronic
1134619234 16:15675120-15675142 GTGCTCAAGGGGCAGGAGGTGGG + Intronic
1135677821 16:24432203-24432225 GTATTTAAGGAGCAGAAAGAAGG + Intergenic
1136103508 16:28012237-28012259 GTGTTTAAGGGGTGGTGGGAGGG - Intronic
1136686413 16:31997213-31997235 GTGTTTTGGGGGCAGCAGCAGGG + Intergenic
1136787024 16:32940742-32940764 GTGTTTTGGGGGCAGCAGCAGGG + Intergenic
1136882748 16:33913047-33913069 GTGTTTTGGGGGCAGCAGCAGGG - Intergenic
1137378903 16:47979490-47979512 TTGTAAAAGAGGCAGGAGGAGGG - Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1137527185 16:49246588-49246610 TTATTTGAGGGGCAGAAGGAAGG - Intergenic
1137589023 16:49682208-49682230 GAGAAAAAGGGGCAGGAGGAAGG - Intronic
1138734976 16:59240038-59240060 GGCTTGAAGGGGCAAGAGGACGG + Intergenic
1139803602 16:69544609-69544631 GTTTCTAAGGGGAAGGAGAAAGG + Intergenic
1140404703 16:74700921-74700943 GTGTGGAAAGGACAGGAGGAAGG - Intronic
1141178172 16:81734372-81734394 GAGTGTGAGGAGCAGGAGGAGGG + Intergenic
1142223560 16:88866605-88866627 ATGGTAGAGGGGCAGGAGGAAGG + Exonic
1203089263 16_KI270728v1_random:1202412-1202434 GTGTTTTGGGGGCAGCAGCAGGG + Intergenic
1142709962 17:1717656-1717678 GTGGATAAGGGGATGGAGGAGGG - Intronic
1143523577 17:7460319-7460341 GGGTATGAGGGGTAGGAGGATGG + Exonic
1143585406 17:7848119-7848141 GTATTTTGGTGGCAGGAGGAAGG - Exonic
1145058197 17:19716663-19716685 ATGAGTAAGGGGCAGGAGGAGGG + Intronic
1146450021 17:32965414-32965436 AAGATCAAGGGGCAGGAGGAAGG + Intergenic
1146460678 17:33043829-33043851 GTGATTCCAGGGCAGGAGGAGGG - Intronic
1146795956 17:35781088-35781110 ATGTTTAAGGAACAGAAGGAAGG + Intronic
1147147372 17:38492882-38492904 GTGTTTTGGGGGCAGCAGCAGGG + Intronic
1147976903 17:44253068-44253090 GGGGGTGAGGGGCAGGAGGATGG + Intronic
1147977342 17:44255351-44255373 GTGAATATAGGGCAGGAGGAAGG - Intronic
1148837637 17:50474268-50474290 GTGTGTAAGGTGGAGGAGGCTGG + Intronic
1149098673 17:52876184-52876206 TTGTTGCAGGGGCAGGAGGTGGG + Intronic
1149313422 17:55418000-55418022 GTGTTTAAGGAGCAGAAAGGAGG - Intronic
1149333108 17:55606808-55606830 ATTTTTAAGAAGCAGGAGGAAGG - Intergenic
1149461356 17:56832687-56832709 GTGTTTAAGAGGGAGGAGGAGGG - Intronic
1149899776 17:60464422-60464444 GAGTTTAAGGGGTTGGAGGAAGG - Intronic
1150249046 17:63696118-63696140 GGGTGGAAGGGGCAGGAGGGTGG - Exonic
1150679177 17:67270678-67270700 GGGTGTCAGGGGCTGGAGGAAGG - Intergenic
1152365613 17:79854671-79854693 GTGTTTGAGGACCAGAAGGAAGG + Intergenic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153291593 18:3507018-3507040 GTGTGTATGGGGCAGGGGGTGGG + Intronic
1154036109 18:10803981-10804003 GTGTTTCAGGTGCAGGATGAGGG - Exonic
1156384767 18:36595150-36595172 GTGTTTCAGTGGCAGGAGCTGGG - Intronic
1156591230 18:38490945-38490967 GTGGAACAGGGGCAGGAGGAAGG - Intergenic
1157647653 18:49292967-49292989 GTGGGTAAGGGGCTAGAGGAGGG - Intronic
1158883235 18:61801037-61801059 GGGTTTAAGAGGCAGGGGGCAGG - Intergenic
1160384719 18:78488214-78488236 GATTTGCAGGGGCAGGAGGAAGG - Intergenic
1161521246 19:4724529-4724551 ATGTCTAAAAGGCAGGAGGAAGG + Intronic
1161716726 19:5880512-5880534 GTGGGGAAGGGGCAGGGGGAGGG - Intronic
1162066580 19:8129407-8129429 GTGTGTCCGAGGCAGGAGGAGGG + Intronic
1162086531 19:8252842-8252864 GACTTTAAGAGGCAGGAGGCAGG + Intronic
1162117787 19:8442031-8442053 GTGATTGAGGGGCAGGTGGCTGG + Intronic
1163667414 19:18609900-18609922 ATGTGTAAGGGGCAGAAGGAGGG + Intronic
1163827332 19:19530969-19530991 ATGTTCAAGGGGCAGAAGGGAGG - Intronic
1165856051 19:38879717-38879739 GTGGGTCAGGGGCAGGAGCAGGG + Intronic
1167075404 19:47245494-47245516 GCGTTTAGGGGGCAGCCGGAAGG + Intergenic
1167741944 19:51329163-51329185 GGGTTTTGGGGGCGGGAGGACGG - Exonic
1168078069 19:53991476-53991498 GTGTTTTAAGGGGACGAGGAAGG - Intergenic
1168262659 19:55205270-55205292 TTGTTTAAGGGGCAGTAGGCAGG - Intronic
1202714507 1_KI270714v1_random:34669-34691 GTCTTCAAGAGGGAGGAGGATGG - Intergenic
925189956 2:1874807-1874829 GTGGAAATGGGGCAGGAGGATGG - Intronic
925200030 2:1959671-1959693 GTGTGTGAGGGGCAGAGGGATGG - Intronic
926212581 2:10882058-10882080 CTGTTGTGGGGGCAGGAGGAGGG - Intergenic
927259734 2:21075893-21075915 GTGTATAGGGGGCTGGAGGCAGG + Intergenic
928955849 2:36866443-36866465 GTGTTTAATGGTCAGGAGTGTGG + Intronic
929811156 2:45190407-45190429 GCATTCAAGGAGCAGGAGGAAGG - Intergenic
930049840 2:47206473-47206495 GTGTTTACTGGGCAAGAGGGAGG + Intergenic
930335921 2:50045525-50045547 GTCTGTGAGGGGAAGGAGGAAGG - Intronic
930732765 2:54744297-54744319 GTGCCTAAGGGGCCAGAGGAAGG + Intronic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
931032339 2:58192345-58192367 GTGTTTTATGGGCAGTGGGATGG - Intronic
931716659 2:65034197-65034219 GTGTTTAAAGAGCAGAAAGAAGG + Intergenic
932831051 2:74990618-74990640 GAGATAAAGGGGCAGAAGGAGGG - Intergenic
933947751 2:87301494-87301516 GTGTTTCAGGGGCAGAAAGGAGG + Intergenic
934951476 2:98578629-98578651 GTGTGCTAGGGGCAGGCGGATGG - Intronic
935687846 2:105699913-105699935 GTGTTTGAGGAGGAGAAGGAAGG - Intergenic
936332451 2:111560079-111560101 GTGTTTCAGGGGCAGAAAGGAGG - Intergenic
936767318 2:115868594-115868616 ATATTTCAGGGGCAGGGGGAGGG + Intergenic
936979131 2:118247857-118247879 GTGTCTATGGGGCAGGAGAATGG - Intergenic
937017637 2:118620260-118620282 GTGTTCAAGGGGCAGGAGCATGG - Intergenic
937124069 2:119462082-119462104 GTGTTGTAGGGGCAGGAGCCAGG + Intronic
937760172 2:125591180-125591202 GTGGGTAGGGGGCAAGAGGAGGG + Intergenic
938035599 2:128032384-128032406 GTGTTTAATTGACAGGAGGTGGG - Intergenic
938134231 2:128740648-128740670 GTGTTGAAGGGTGAGGATGAAGG - Intergenic
938140389 2:128790230-128790252 GGCCTTCAGGGGCAGGAGGAGGG + Intergenic
938587318 2:132704022-132704044 GGGTTTCAGGGGCAGGAGAAGGG - Intronic
939523679 2:143264354-143264376 GTCTTTAAGGTTCTGGAGGAAGG - Intronic
941000847 2:160202371-160202393 ATGTTTGTGGTGCAGGAGGAGGG + Intronic
941369206 2:164643491-164643513 GTATTTGAGGAACAGGAGGAAGG - Intergenic
942568927 2:177293881-177293903 GTGTTGTAGGGGGAGAAGGAGGG - Intronic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
944646557 2:201786133-201786155 GAATTTAAGGGGCAGGTGAAAGG - Intergenic
944744700 2:202643633-202643655 GTTTCTAGGGGGCAGGAAGAGGG - Intronic
944894085 2:204146092-204146114 GTGCTCAAGGAGCCGGAGGAAGG - Intergenic
944924680 2:204452498-204452520 GAGTTTAAGGGGCAGGATATGGG - Intergenic
946708599 2:222484266-222484288 GTGGGGAAGGGGCAGCAGGAAGG - Intronic
947116926 2:226781845-226781867 GTATTTAGGGGTGAGGAGGAGGG - Intronic
947938320 2:234026203-234026225 GTTTTGAAGGGGCTGGAGGGTGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948444661 2:238022988-238023010 GTGTGAAGGGGACAGGAGGAAGG + Intronic
1168863538 20:1063900-1063922 GTATTTAAGGGACAGAAGGAAGG - Intergenic
1168919398 20:1518503-1518525 GGGTTTGTGGGGCAGGAGAAGGG + Intergenic
1168980425 20:1998871-1998893 GTGTTTGAGGAGCAGCAGGGAGG - Intergenic
1170120800 20:12909587-12909609 TTGCTTAAGGGGCAAGAGGGAGG - Intergenic
1170476976 20:16725118-16725140 GTGTGTGTTGGGCAGGAGGAGGG + Intergenic
1170765064 20:19282798-19282820 GTGTTTTGGGGGCAGGTGGTTGG + Intronic
1170913873 20:20603542-20603564 GAGTTTCAGGGGCAGTAAGAGGG - Intronic
1171327266 20:24305569-24305591 GGGTTGAAGGAGGAGGAGGAAGG + Intergenic
1171401412 20:24875027-24875049 CTGCTTAAGGGGCAGGAGGTGGG - Intergenic
1172276694 20:33684032-33684054 GTACTTAAGGGCCAGGAGGCTGG - Intronic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1173976504 20:47190641-47190663 CAGTTTAATGGGCAGGTGGATGG + Intergenic
1174549858 20:51354636-51354658 CTCTTTAAGGAGCATGAGGAAGG - Intergenic
1174567724 20:51478817-51478839 GTGTTCAGGGAACAGGAGGATGG - Intronic
1175100534 20:56575827-56575849 GGGTTTAGGGAGGAGGAGGAGGG - Intergenic
1175163898 20:57029554-57029576 AGGTTCAAGGGGCAGGAGGCTGG + Intergenic
1176212529 20:63931967-63931989 GTGCTTGAGGGGCCGGAGGCAGG + Exonic
1177646766 21:23908755-23908777 GTGTTTAAGGAGCACCAGGAAGG + Intergenic
1179720834 21:43315317-43315339 GTGTTCTAGTGGCAGGAAGAGGG + Intergenic
1180252858 21:46601119-46601141 GTGTTTTCAGGGCAGGGGGAGGG - Intronic
1180800094 22:18627687-18627709 GTGCACAAGGGGCAGGGGGAGGG - Intergenic
1181221621 22:21367579-21367601 GTGCACAAGGGGCAGGGGGAGGG + Intergenic
1181260514 22:21593853-21593875 ATGTTTAAGAGTGAGGAGGAAGG - Intronic
1182003408 22:26939617-26939639 GGGTTTAGGGGGCAGCAGGGGGG - Intergenic
1182447061 22:30395998-30396020 GTGTTGAGGGGGCAGAAGTATGG + Intronic
1182786919 22:32915677-32915699 GTGGGTAAGGGGCAGGAGGGTGG + Intronic
1183131480 22:35840652-35840674 GTGTGTAGGGGGGAGGAGGTAGG + Intronic
1183453326 22:37907978-37908000 TTGTTTGAGGGGCAGGAGTGAGG + Intronic
1183647127 22:39133385-39133407 GGGAGGAAGGGGCAGGAGGAAGG - Exonic
1183671788 22:39277393-39277415 GCGTTCCAGGGGCTGGAGGAGGG + Intergenic
1183851824 22:40596059-40596081 GTGGGTAATGGGGAGGAGGAGGG - Intronic
1183987487 22:41577514-41577536 GTTCTGAAGGGGCAGGAGGAGGG - Intronic
1184270387 22:43377999-43378021 CTTTTCAAGGGCCAGGAGGAAGG - Intergenic
1184545533 22:45164513-45164535 GGGCTTAAGGGGCTGGAGGACGG + Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
950185021 3:10939564-10939586 GAGGTTAGGGGACAGGAGGAGGG - Exonic
950342334 3:12258386-12258408 GTATTCAAGGAGCAGGTGGATGG + Intergenic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
951071556 3:18334768-18334790 GTTTTCCAGGGGCTGGAGGAAGG - Intronic
952365973 3:32675282-32675304 GAGATTATGGGGCAAGAGGAAGG - Intergenic
952580868 3:34831954-34831976 ATGAGTAAGGGGCAGGAGAAGGG + Intergenic
953033109 3:39190778-39190800 GTGGGTCAGGGGCAGCAGGAGGG - Intronic
954424087 3:50434282-50434304 GTGTTTTGGGGGCAGGGGGGCGG - Intronic
955002232 3:54938121-54938143 GTGTCTGAGGGGCAGCAGAATGG + Intronic
955062727 3:55507134-55507156 GTTGTTAAGGGGCAGCTGGAGGG + Intergenic
956536242 3:70280222-70280244 CTTTTTAAGGGAGAGGAGGAGGG - Intergenic
957287928 3:78241028-78241050 GTTTTTAAGGGGAATGATGATGG - Intergenic
957700488 3:83704399-83704421 GTGTTTAAAGGGAAAGAGGGTGG - Intergenic
959496780 3:107061014-107061036 GTGTTTGAGGGTAGGGAGGAAGG + Intergenic
961333989 3:126159277-126159299 CTGGTGACGGGGCAGGAGGAGGG - Intronic
961664951 3:128489041-128489063 GTGGGTCGGGGGCAGGAGGAGGG + Intronic
961772689 3:129261508-129261530 GTTCTTTTGGGGCAGGAGGAAGG + Intronic
961867902 3:129967383-129967405 GTGCTTAAAGGCCATGAGGAGGG - Intergenic
962268714 3:133962475-133962497 GAGTTCAAGGGGCAGGAAGAAGG + Intronic
964247445 3:154669905-154669927 ATGTTGAAGAGGCAGCAGGATGG + Intergenic
965449253 3:168817315-168817337 CTGATTAAGAGGCAGTAGGAAGG + Intergenic
966302831 3:178497956-178497978 GTGTTGGAGGGGTAGGAGGAGGG - Intronic
966890777 3:184406112-184406134 GAGCTTAAGGGGCAGGAGGTGGG - Intronic
967276469 3:187780326-187780348 GTGTGTAGGGGGCAGAAGGTTGG - Intergenic
968022407 3:195405094-195405116 GTGTTTAAGCGGCAATAGGCTGG - Intronic
968740653 4:2330097-2330119 AGGGTTAAGGGGCAGGATGAAGG + Intronic
969857574 4:10012757-10012779 GTGTTTGAGGGGCAGCAAGTGGG + Intronic
971750056 4:30635415-30635437 GAGTTTAGGGTGCAGGAGAATGG + Intergenic
971894665 4:32576832-32576854 GTTTTTAAGGGGGAGGACTATGG + Intergenic
972238942 4:37167831-37167853 CTGTTGGAGGGGCAGGGGGATGG + Intergenic
972343686 4:38175181-38175203 GTGTTTCTGGGGCAGATGGATGG - Intergenic
972385641 4:38563010-38563032 GAGTTTGATGAGCAGGAGGAAGG - Intergenic
972582180 4:40404653-40404675 GTGTTTACGGGACAGAGGGAAGG - Intergenic
972668299 4:41189352-41189374 GTCTGGAAGGGGCAGGAGGAAGG + Intronic
973303585 4:48617630-48617652 GTGTTAAAAGAGGAGGAGGAGGG + Intronic
973798020 4:54448811-54448833 TTGGTCAATGGGCAGGAGGAGGG - Intergenic
975088089 4:70366976-70366998 GTATTTAGGGTGCAGGAGTAGGG - Exonic
976035873 4:80820490-80820512 GTGTTTAAGGAACAGCAAGAAGG + Intronic
976151219 4:82094044-82094066 GTGTTTATGTGGGAGCAGGATGG - Intergenic
977937974 4:102827580-102827602 GCGGTGAAGAGGCAGGAGGAGGG - Intronic
978018228 4:103775173-103775195 TTGATCAAGAGGCAGGAGGATGG - Intergenic
979438992 4:120728666-120728688 GTATGTAAGGGGCAGGGGGCGGG - Intronic
979969696 4:127118978-127119000 GAGTTTTAAAGGCAGGAGGAGGG - Intergenic
980082852 4:128362765-128362787 GTGTTTAGGGTACTGGAGGAAGG + Intergenic
981758112 4:148163094-148163116 GGGTTTAAAGGGCAGAAGAAGGG + Intronic
981893983 4:149774732-149774754 GAGTTTAATAGGCAAGAGGAAGG - Intergenic
982677630 4:158394299-158394321 GTGTTTGAAGTGAAGGAGGAAGG + Intronic
983092551 4:163521868-163521890 GTGCTTCAGGGGCAGGAGATTGG + Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
986351662 5:6885738-6885760 GAGTTTGAGAGGCAGGAGGTAGG + Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
987125244 5:14806114-14806136 GTGTTGAAGTGGCAGAAGGGTGG - Intronic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
988391208 5:30634594-30634616 GTTTTTTAGGGGCTTGAGGAAGG - Intergenic
989543114 5:42641124-42641146 GTCTATCAGGGGAAGGAGGAAGG - Intronic
989683317 5:44055187-44055209 GTGGTTAGGGGGCAGGGGGCTGG + Intergenic
990943901 5:61230252-61230274 GAGTTTAAGGGGAAGGGAGACGG + Intergenic
991341485 5:65615511-65615533 TTTTTTAAGAGCCAGGAGGAAGG - Intronic
991584828 5:68191237-68191259 CTGCTTAGGGGGCAGGAGGCAGG - Intronic
993741454 5:91545826-91545848 GTCTTTCAGGGGGTGGAGGATGG - Intergenic
993909257 5:93661427-93661449 CTGTTTCAGGGACAGGAGTAAGG + Intronic
994063197 5:95504702-95504724 GTGTTTAAGGGAGAGGAAGCCGG + Intronic
994165413 5:96602959-96602981 GTGTTCAAGGACCAGGATGAAGG + Intronic
995098469 5:108269187-108269209 GCTTTTAAGGAGTAGGAGGAAGG + Intronic
995352348 5:111194145-111194167 GTCTTGGAGGTGCAGGAGGAAGG - Intergenic
996507563 5:124285454-124285476 GTCTTTAAAAAGCAGGAGGAGGG + Intergenic
997183879 5:131861491-131861513 ATGTTTAATGGGCATGGGGAAGG + Intronic
997279130 5:132627594-132627616 GTGTTCAAGGACCAGGAAGAAGG + Intronic
997508267 5:134435339-134435361 CTGTTTAAGGGGCTGAAGGGAGG + Intergenic
997958905 5:138303509-138303531 GTGTTTATGGGACAGCAAGAAGG - Intronic
998131307 5:139652448-139652470 GGCTTTAGGGGGCAGGTGGAGGG - Intronic
998194977 5:140060965-140060987 GTGTTTAAGGAACAGCAGGTTGG - Intergenic
998334051 5:141355303-141355325 GTGTTTGAGGAGCAGGAAGAAGG + Exonic
998602843 5:143602794-143602816 GTTTTTAGCGGGTAGGAGGAAGG + Intergenic
999498130 5:152120126-152120148 GTGTTTGAGGGGCAGAAAGGAGG + Intergenic
999746010 5:154592432-154592454 GGGTGTAGGGGGCAAGAGGAGGG - Intergenic
1000268453 5:159659989-159660011 GTGTTCAAGGACCTGGAGGAAGG + Intergenic
1000593384 5:163185552-163185574 GTGTTAGCGGGTCAGGAGGAAGG + Intergenic
1001480973 5:172089084-172089106 TTGTTTAAGGGACTGGTGGAGGG - Intronic
1002136605 5:177111736-177111758 GTGTTTCAGGGGCCTGAGGAGGG + Intergenic
1002163497 5:177331202-177331224 ATGTGCAAGGGGCTGGAGGATGG - Intergenic
1002521304 5:179794490-179794512 CTTTTTAGGGGGCTGGAGGAAGG - Intronic
1003199398 6:3945237-3945259 GTTTTGATGGGGCAGGAGTAAGG - Intergenic
1003858686 6:10301679-10301701 ATTTTTGAGGGGCAGGAGGTGGG - Intergenic
1004726067 6:18312351-18312373 GGGTGAAAGTGGCAGGAGGAGGG + Intergenic
1004892678 6:20116490-20116512 GTTTGTAAGGGACAGAAGGAAGG + Intronic
1005171776 6:22994077-22994099 ATGTTTAATGGGAAGGAGCAAGG + Intergenic
1006200502 6:32284642-32284664 GGGTGTGAGGGGCAAGAGGAGGG + Intergenic
1006416428 6:33906930-33906952 GTCATTAAGAGGCAGGTGGAGGG + Intergenic
1006444758 6:34074018-34074040 GGGTTTCAGAGGCAAGAGGAGGG - Intronic
1006793395 6:36717706-36717728 GGGTTATAAGGGCAGGAGGACGG + Intronic
1007182752 6:39942219-39942241 GTTTCTAAGGGGCAGGAGCCTGG - Intergenic
1007476370 6:42122430-42122452 CTGTTTATGGGCCAGGATGAAGG + Intronic
1007952738 6:45886534-45886556 GTAATTATGGGGCAGGAGAATGG + Intergenic
1009979132 6:70705672-70705694 GTGTTTAAGGAGTGGCAGGATGG + Intronic
1010028277 6:71245137-71245159 GAGTTAAAGGGGCTGGAGGGTGG - Intergenic
1011444348 6:87422021-87422043 GTGTTTAAAAGGTAGGGGGAAGG + Intronic
1011735613 6:90308115-90308137 CTTTTTAAGAGGGAGGAGGAGGG - Intergenic
1012521981 6:100132392-100132414 GTGTTTCTGTGGCAGGATGAGGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1014087379 6:117363112-117363134 GTGCTTAAGTGGTAGTAGGAAGG - Intronic
1015589124 6:134805463-134805485 GCGTGTAAAGGGCTGGAGGAGGG - Intergenic
1015984246 6:138869809-138869831 GTCTTTCAGGGGGAGGAAGAAGG - Intronic
1017936240 6:159007758-159007780 ATGTTTAAGGAGCAAAAGGAAGG + Intergenic
1018002218 6:159589387-159589409 GTGTGTAAAGAGCAGGAGGCTGG - Intergenic
1018380495 6:163254309-163254331 CTGATGAAGGGGGAGGAGGATGG + Intronic
1018736053 6:166688059-166688081 GTATTCAAAAGGCAGGAGGAGGG + Intronic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019878144 7:3834193-3834215 GTGTTTAAAGGGCAGGGAGTTGG - Intronic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022868189 7:34445104-34445126 GTGTTTGAGGAGCAGAAAGAAGG + Intergenic
1022905930 7:34856825-34856847 ATGATTGAGAGGCAGGAGGAGGG + Intronic
1023420851 7:39977999-39978021 GTATTTAAGGAGAAGGAGGGTGG + Intronic
1024394116 7:48846703-48846725 AAGTTAAAGGGGCAGGAGAATGG - Intergenic
1024401122 7:48925711-48925733 AGGTTAAAGGGGCAGGAGAATGG + Intergenic
1024518255 7:50279881-50279903 GGGGTTAGGGGGCAGGGGGAGGG + Intergenic
1026418537 7:70208834-70208856 GTGTTCAAGGGACAGGAAAAAGG + Intronic
1026525499 7:71149976-71149998 GTGTGTCGGGGGCTGGAGGAGGG + Intronic
1027251038 7:76398857-76398879 GTGTTTAAGGGGCAGGAGGATGG + Intronic
1029337459 7:99914645-99914667 ATGTTTATGGGGTAGGAAGAAGG - Intronic
1029356847 7:100058400-100058422 GAGATTTAAGGGCAGGAGGAGGG - Intronic
1031024806 7:116668758-116668780 GGGGTGATGGGGCAGGAGGAAGG + Intergenic
1031784245 7:126008897-126008919 GTGTGTTGGGGGCAAGAGGAGGG - Intergenic
1032077059 7:128840975-128840997 GTGGCTGGGGGGCAGGAGGAGGG + Intronic
1032460035 7:132103429-132103451 GTGGTGGAGGGACAGGAGGAAGG - Intergenic
1032999860 7:137492423-137492445 GGGTTTAAGGGGGAGGAAGCTGG + Intronic
1033179508 7:139162103-139162125 GTATTTATGGGACAGGAAGAAGG + Intronic
1033606195 7:142929938-142929960 GTGATGGAGGGTCAGGAGGATGG - Intronic
1033618121 7:143036909-143036931 GGGGTTGAGGGGCAAGAGGAGGG + Intergenic
1033633479 7:143184883-143184905 GTGTTTAAAAGGCATGTGGAGGG - Intergenic
1034016946 7:147597705-147597727 GTGATGAAGGGGCTGAAGGATGG - Intronic
1034041684 7:147884179-147884201 GTGTTTAAGGAGCAGCAAGATGG + Intronic
1035480888 7:159183752-159183774 GTGTTTAAGGCCTAGGATGATGG + Intergenic
1035913047 8:3589601-3589623 GGGTATCAGGGGCTGGAGGAAGG + Intronic
1036585855 8:10122677-10122699 GAGTGTAGAGGGCAGGAGGAAGG - Intronic
1036679742 8:10863127-10863149 ATGTTTAAGGGGCAGGACTGGGG - Intergenic
1037139318 8:15501144-15501166 GTGGTTAAAGGTCAGGATGAAGG - Intronic
1037637098 8:20710013-20710035 CTGTTGCGGGGGCAGGAGGAGGG - Intergenic
1038229870 8:25689924-25689946 GTGTTTCAGGGGTCTGAGGAAGG - Intergenic
1038327157 8:26579761-26579783 GTGTTCACTGTGCAGGAGGAAGG + Intronic
1038885960 8:31663410-31663432 GTGGTTTGGAGGCAGGAGGAAGG - Intronic
1039347047 8:36716668-36716690 GTGATTCAGGAGGAGGAGGAAGG - Intergenic
1041095796 8:54348317-54348339 GTGGTTATAGGGCAGGGGGAGGG - Intergenic
1041180942 8:55247287-55247309 CAGTTTAAGGGGCAGGAAAAAGG - Intronic
1041689227 8:60672993-60673015 TTGTTTAAGTGGCAGGGGTAAGG - Intergenic
1041695186 8:60728400-60728422 ATGTTTTTGTGGCAGGAGGAAGG + Intronic
1041703222 8:60815445-60815467 CTGTTTGAGGGGCAGGGAGAGGG + Intronic
1041734468 8:61095269-61095291 GTTTTTTAGGGGCAGGAGGTAGG + Intronic
1042582733 8:70299335-70299357 GTGTTTCAAGGGAAGGAGTAGGG + Intronic
1042815576 8:72874729-72874751 TTGTGTCAGGAGCAGGAGGAGGG + Intronic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1044316055 8:90751186-90751208 GTCTTTCAGGGGCTGGACGAGGG + Intronic
1044728491 8:95212136-95212158 GTGGTTTAGGGGGAGGAGGGGGG + Intergenic
1045412225 8:101930529-101930551 GTGGTCAAGGAGCTGGAGGAGGG - Intronic
1045593403 8:103625106-103625128 GTTTTTAGGGGGAAGGAGGTTGG + Intronic
1046015158 8:108596038-108596060 GGGTTTAAGAGGCAAGGGGAGGG + Intergenic
1046619601 8:116514406-116514428 GTGTTGAAGAGACAGGAAGAAGG - Intergenic
1046737872 8:117796312-117796334 CTGTTTAAAGGGCAGGATCAGGG - Exonic
1047169651 8:122479552-122479574 GTGGTTACGAGGCAGGAGAATGG + Intergenic
1049033831 8:140059103-140059125 GTTGTAAAGGGGCAGGAGGAAGG - Intronic
1049230675 8:141479644-141479666 GTGTTTAAGAAGGAGGAGGAGGG + Intergenic
1049425694 8:142537011-142537033 GTGGTTGACCGGCAGGAGGAGGG + Exonic
1050119263 9:2291595-2291617 GTATTTAGGAGGAAGGAGGAGGG - Intergenic
1050143093 9:2537263-2537285 GTGCTAAAGGAGCATGAGGATGG + Intergenic
1050177551 9:2884065-2884087 GTAGTCAAGGGGCAGGAGTAGGG - Intergenic
1050340854 9:4637177-4637199 GTGTTTGAGGGACAGCAAGAAGG - Intronic
1050478451 9:6064880-6064902 TTGCTGAAGGGGCATGAGGAAGG + Intergenic
1050833792 9:10050200-10050222 ATGTTTCAGGGGCAGTAGGTGGG + Intronic
1051423245 9:16909584-16909606 GTGTTTGTGGGGATGGAGGAAGG + Intergenic
1052062906 9:23983061-23983083 GTGTTTTAGGGGCAAGTGGGTGG + Intergenic
1052625348 9:30968459-30968481 GTCTTTAATGGAAAGGAGGAAGG + Intergenic
1052923500 9:33992593-33992615 TTGCTTGAGGGGCAGTAGGATGG - Intronic
1053021090 9:34694764-34694786 GGCTTGAAGGGGCAAGAGGAGGG - Intergenic
1054829241 9:69605112-69605134 ATTTTTAAAGGGCAGGAGAAAGG - Intronic
1054854677 9:69885667-69885689 GTGTTTAATGGGGTGGAGGTTGG + Intronic
1054920665 9:70539493-70539515 TTGGTTATGGGGCAGCAGGAGGG - Intronic
1056564835 9:87761908-87761930 GTGTTTCAGGAGGAGGAGGTAGG + Intergenic
1057495278 9:95555515-95555537 GTGTCTGAGGGACAGGAGGGAGG - Intergenic
1057608918 9:96523355-96523377 AAGTTAAAGGGGCAGGAGAATGG - Exonic
1059538202 9:115103817-115103839 CTGTTCAAGGGGCAGGAGGGAGG - Intronic
1059990675 9:119862330-119862352 GGTTTTTAGGGGCAGGAGGCTGG - Intergenic
1060463670 9:123883024-123883046 GTGTTTGAGGAGCAGAAAGAAGG - Intronic
1060499098 9:124139358-124139380 GTGTTCAGGGGGCAGGAGATGGG - Intergenic
1061075102 9:128336431-128336453 GTGTTCAGGGAGCAGGATGAAGG - Intergenic
1061397726 9:130352711-130352733 GTGTGGAAGGTGCAGGAGGTGGG - Intronic
1061484142 9:130911866-130911888 GTGTTTCAGCGCCGGGAGGACGG - Exonic
1061537279 9:131257972-131257994 GTATCTGGGGGGCAGGAGGATGG - Intergenic
1061537826 9:131260461-131260483 GGGGCTCAGGGGCAGGAGGAGGG - Exonic
1062298678 9:135850848-135850870 GTTTGTAAAGGGCAGGGGGAAGG + Intronic
1185499333 X:585095-585117 GTGGAGAAGGGGGAGGAGGAGGG + Intergenic
1186355788 X:8788270-8788292 GTGTAAAAGAGGCAGGAGAAAGG + Intergenic
1186377524 X:9020392-9020414 GTGTAAAAGAGGCAGGAGAAAGG + Intergenic
1186569433 X:10698762-10698784 GCCTTTACGGGGAAGGAGGAAGG - Intronic
1186655241 X:11605129-11605151 GTGCACAAGGGACAGGAGGAGGG + Intronic
1186739876 X:12506021-12506043 GTGTTTATGGAGCAGCCGGAGGG - Intronic
1187280171 X:17852549-17852571 GTGTTTGGGGGGCAGGGAGAGGG - Intronic
1187499148 X:19824463-19824485 TTGTTTTGGGGGCAGGAGTAGGG - Intronic
1187782710 X:22846491-22846513 ACAATTAAGGGGCAGGAGGATGG + Intergenic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1188243352 X:27814193-27814215 GGGTGTGAGGGGCAGGGGGAGGG - Intronic
1188923967 X:36016281-36016303 GTGGATGAGGGGCAGGATGAGGG - Intergenic
1189990896 X:46593904-46593926 CTATTTAAGGGGCAGGATAAAGG - Intronic
1190398266 X:50006571-50006593 GTGTTCAAGGGGCTGGAAAAGGG + Intronic
1190434888 X:50414186-50414208 GTGGTTGAGGGAGAGGAGGAGGG + Intronic
1190437306 X:50438213-50438235 GGGTGGAAGGGGCAAGAGGAGGG - Intronic
1192418157 X:71003143-71003165 GGGGTTAAGGGGCAGGGGGATGG + Intergenic
1193102292 X:77627860-77627882 GTATTTAGGGGGCAGGGAGATGG - Intronic
1193664040 X:84294056-84294078 GTGATTTAGGCTCAGGAGGAGGG - Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194113221 X:89864096-89864118 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1195394208 X:104393605-104393627 GTGCTTGAGGAGCAGCAGGAAGG + Intergenic
1196373157 X:115001153-115001175 CAGTTTTAGGGGCAGGAAGATGG + Intergenic
1197397276 X:125941954-125941976 GTTTTTAAGGGGGAGGATGAGGG + Intergenic
1197541235 X:127764493-127764515 GTTTTTAAGGGGCAGGTGTGAGG - Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1197892185 X:131278800-131278822 GGGTTCAAGGGCAAGGAGGAGGG - Intronic
1199436206 X:147815406-147815428 GTGCTGAAGGTCCAGGAGGATGG - Intergenic
1200049341 X:153420489-153420511 GAGATGAAGGGGCGGGAGGATGG - Intronic
1200465906 Y:3519155-3519177 CTGTTTAAGTTGCAGGAGAAGGG - Intergenic
1200685026 Y:6250448-6250470 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1200990554 Y:9341718-9341740 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1200993216 Y:9362035-9362057 GTGTTTGTGGGTCAGGGGGACGG - Intronic
1200995872 Y:9382306-9382328 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1200998536 Y:9402658-9402680 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1201001046 Y:9471188-9471210 GTGTTTGTGGGTCAGGGGGACGG - Intronic
1201003712 Y:9491516-9491538 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1201006368 Y:9511797-9511819 GTGTTTGTGGGTCAGGGGGACGG - Intergenic
1201009023 Y:9532106-9532128 GTGTTTGTGGGTCAGGGGGACGG - Intergenic