ID: 1027253265

View in Genome Browser
Species Human (GRCh38)
Location 7:76412869-76412891
Sequence ATGTAAACATTGAGGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027253263_1027253265 3 Left 1027253263 7:76412843-76412865 CCGTCTCAGAAAGAAAAAAAAAA 0: 43
1: 3281
2: 89484
3: 68576
4: 105275
Right 1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG No data
1027253261_1027253265 29 Left 1027253261 7:76412817-76412839 CCAGCCTGGGCAACAAGAGCAAA 0: 10230
1: 20444
2: 30144
3: 27240
4: 59209
Right 1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG No data
1027253262_1027253265 25 Left 1027253262 7:76412821-76412843 CCTGGGCAACAAGAGCAAAACTC 0: 9641
1: 20012
2: 29339
3: 23777
4: 16628
Right 1027253265 7:76412869-76412891 ATGTAAACATTGAGGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027253265 Original CRISPR ATGTAAACATTGAGGAAGCT AGG Intronic
No off target data available for this crispr