ID: 1027255177

View in Genome Browser
Species Human (GRCh38)
Location 7:76426375-76426397
Sequence GCCTGTCCTCTCCCGCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 333}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027255163_1027255177 25 Left 1027255163 7:76426327-76426349 CCAGCTAAACCCTGATCCCTGGA 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255167_1027255177 9 Left 1027255167 7:76426343-76426365 CCCTGGACCAAGTTCCTGTGGTC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255168_1027255177 8 Left 1027255168 7:76426344-76426366 CCTGGACCAAGTTCCTGTGGTCC 0: 1
1: 0
2: 0
3: 15
4: 117
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255165_1027255177 15 Left 1027255165 7:76426337-76426359 CCTGATCCCTGGACCAAGTTCCT 0: 1
1: 0
2: 0
3: 9
4: 185
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255160_1027255177 27 Left 1027255160 7:76426325-76426347 CCCCAGCTAAACCCTGATCCCTG 0: 1
1: 0
2: 1
3: 6
4: 184
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255164_1027255177 16 Left 1027255164 7:76426336-76426358 CCCTGATCCCTGGACCAAGTTCC 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255170_1027255177 2 Left 1027255170 7:76426350-76426372 CCAAGTTCCTGTGGTCCCATGGA 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255173_1027255177 -5 Left 1027255173 7:76426357-76426379 CCTGTGGTCCCATGGAGGGCCTG 0: 1
1: 0
2: 4
3: 10
4: 224
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255161_1027255177 26 Left 1027255161 7:76426326-76426348 CCCAGCTAAACCCTGATCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027255177 Original CRISPR GCCTGTCCTCTCCCGCCTCA GGG Intronic
900137290 1:1123046-1123068 GCCTCAGCTCTGCCGCCTCAGGG + Intergenic
900678489 1:3903241-3903263 GCCTGGCCTCGCCCGCCCGATGG + Intergenic
900901180 1:5517049-5517071 GGCTGTCTTCTCCTCCCTCAAGG + Intergenic
901037084 1:6342851-6342873 GCCTGGCCTTTGCCACCTCACGG + Intronic
903185476 1:21626528-21626550 GCCCCTCCTCTCCCTCCTCTTGG - Intronic
903275617 1:22219464-22219486 GCCTTTCCTCTTCTGCCTCTGGG + Intergenic
903321060 1:22543430-22543452 GCCTTCCCTTTCCCGGCTCAGGG - Intergenic
903337595 1:22635394-22635416 GCCTGGCTTCTCCCTCCTCTTGG - Intergenic
903478152 1:23634629-23634651 CCCTGCCCTCTCCCAGCTCAGGG - Intronic
904026252 1:27505390-27505412 GCCTGTCCTCTCCAGCCCCCTGG + Intergenic
904449811 1:30603617-30603639 GGCTGTCCACTCCTGTCTCAGGG - Intergenic
905046224 1:35004690-35004712 GCCTCCCCACCCCCGCCTCAGGG - Intronic
907020117 1:51059239-51059261 GCCTGGCCTCTCCCTGCTCCTGG + Intergenic
907619631 1:55963266-55963288 GTCTATCCTCTCCTGCTTCATGG - Intergenic
909401270 1:75233728-75233750 GCCTTTGGTCTCCTGCCTCATGG - Intronic
909607058 1:77518335-77518357 ACCTGCCCCCTCCCGCTTCATGG + Intronic
910758117 1:90712229-90712251 GCCCGTCCTCTCCCTGCTCCAGG - Exonic
911737098 1:101349546-101349568 GCCTGTAGTCTTCAGCCTCAGGG + Intergenic
912704454 1:111901744-111901766 GCCTGACCTCTCCTGCCTGGAGG + Intronic
913329457 1:117655082-117655104 CCCTGCCCCCTCCCGCCTCTGGG + Intergenic
915383168 1:155462437-155462459 GCCTGGCCTCACCCACCTCAGGG + Intronic
915489659 1:156244086-156244108 GCCTGGCCTCTGCCCCCTCCAGG + Exonic
915563478 1:156701051-156701073 GCCTCTCCTCTCTCCCCACAGGG - Exonic
915637339 1:157195880-157195902 GCCTGTCCTCTCCCACTTCCTGG + Intergenic
918142951 1:181733638-181733660 GCCTGACCTCTCCTGCATCACGG + Exonic
920048550 1:203149483-203149505 GCCTGTCCTCCTCCTCCTCTGGG - Intronic
920074354 1:203325776-203325798 GCCTGTCCTCCCCCTTCCCAAGG - Intergenic
921759980 1:218901995-218902017 GCCTGTTCTTTCCATCCTCAGGG + Intergenic
923102489 1:230827488-230827510 GCCTGTCCACCCCCTCCCCACGG + Intergenic
1063996674 10:11626321-11626343 GCCTTTCGGCTCCCGTCTCAGGG - Intergenic
1065117450 10:22496689-22496711 GCCCCTCCTCTCCAGTCTCATGG + Intergenic
1066260401 10:33724207-33724229 GCCTGTCCACTCCTGCATGATGG - Intergenic
1067289265 10:44929522-44929544 GCCTCCACCCTCCCGCCTCAGGG + Intronic
1069271894 10:66539236-66539258 ACCTGCCCTCTCCCACTTCAAGG - Intronic
1070329128 10:75405483-75405505 CCCTGTCCTGCCCCGCCTCGCGG + Intergenic
1071819492 10:89265133-89265155 GCCTGGCCTCTCCCTGCTCCTGG - Intronic
1072714027 10:97737432-97737454 GCCTTCCCTGTCCAGCCTCACGG + Intronic
1072750510 10:97975274-97975296 GGCTGTCCTCAGCCCCCTCACGG + Intronic
1073399035 10:103241788-103241810 CCAAGTCCTCTCCAGCCTCAGGG - Intergenic
1074772488 10:116742769-116742791 GCCTCTCCTCTCCCGGCTTCGGG + Intergenic
1075594120 10:123715661-123715683 GCTTCTCCACTCCAGCCTCAAGG - Intronic
1076206983 10:128611403-128611425 GGCTGTCCTCTCCTGCCTCTTGG + Intergenic
1076720794 10:132391917-132391939 GCCTGGCTTCTTCCGCATCACGG + Intergenic
1076935287 10:133564908-133564930 GCCTGTCCCCTCCCTTCCCAGGG + Intronic
1077030641 11:464590-464612 GCCTGGCCTCTCCCGCTGGAGGG + Intronic
1077113349 11:871686-871708 GCCTGTCCTCCCCTCCCACATGG - Intronic
1077206302 11:1346432-1346454 CCCTGTCCTCACCCACCCCAGGG - Intergenic
1077206461 11:1346886-1346908 GCCCCTCCTCACCCACCTCAGGG - Intergenic
1077811912 11:5646737-5646759 GTCTGCCCTCTCCCTTCTCAGGG - Intergenic
1078442190 11:11377351-11377373 ACCTGTACTCACCCGCATCAAGG - Exonic
1079184201 11:18221539-18221561 GCCTGGCCTCTCCCCACTCCCGG - Intronic
1081746554 11:45477089-45477111 ACCTGTCTTCTCCAGCCTCCTGG + Intergenic
1081853597 11:46290459-46290481 CCCTGCCCTCTGCCGCCCCAAGG + Intronic
1081872739 11:46390929-46390951 GAGTCTCCTCTCCCGCCCCAGGG - Intergenic
1083457705 11:62790094-62790116 GCCTGTAATCCCCCCCCTCAAGG + Exonic
1085043707 11:73341674-73341696 CCATGCCCTCTCCTGCCTCAGGG - Intronic
1085780322 11:79402165-79402187 GCCTGACTTCTCCTGCCCCAGGG - Intronic
1086085174 11:82945989-82946011 GCCTGGCCTCTCCCTGCTCCTGG - Intronic
1088288072 11:108207662-108207684 GCCTGGCCTCTCCCTGCTCCCGG - Intronic
1089351453 11:117823847-117823869 GCCTGTCCTTTCCTGGCCCAGGG - Intronic
1089492574 11:118893115-118893137 GCCTGTGGGCTCCCTCCTCATGG - Intronic
1089734315 11:120539165-120539187 GGCTGTCCTCTCCTCCCACAGGG - Intronic
1090380273 11:126321611-126321633 GCCTGTCCACTCCCTCCTGAAGG - Intronic
1090942879 11:131403918-131403940 GCCTCTCCTCTCTCCCCTCAAGG + Intronic
1091171670 11:133525331-133525353 GCCTGTTCCCTCCTTCCTCAAGG - Intronic
1091239138 11:134040819-134040841 GTCTGACCTCTCCAGCGTCAGGG + Intergenic
1091457714 12:620123-620145 GCCTGTGCTCTCCCGTCACTAGG - Intronic
1091700143 12:2653789-2653811 GCCTCTGCACTCCAGCCTCATGG + Intronic
1092083013 12:5733654-5733676 GTCTGTCCTCTCCTGCATCATGG - Intronic
1092847405 12:12596584-12596606 GCCTCTCCTCTCTCTCCTCTAGG + Intergenic
1093765045 12:22952942-22952964 GCCTGGCCTCTCCCCACTCCCGG - Intergenic
1096251015 12:50032796-50032818 GCCTGACCTCTCCCGCACCTCGG - Intronic
1096499305 12:52055505-52055527 GCCTGTCCTCTCCCAACTCAAGG + Intronic
1097194733 12:57237120-57237142 CTCTGTCCTCTCCCTCCTCCTGG + Exonic
1097697190 12:62786322-62786344 TCCTTTCCTCTCCCGCCTCAGGG - Intronic
1098608716 12:72427364-72427386 GCCTGTCCTCTTCAGCTTCTGGG + Intronic
1098778650 12:74654976-74654998 GCCTTTCATCTCCTGCCACAAGG - Intergenic
1099557502 12:84128502-84128524 GCCTGGCCTCTCCCGGCTCCCGG + Intergenic
1099682249 12:85844018-85844040 GCCTGGCCTCTCCCAACTCTCGG + Intergenic
1101580973 12:106040504-106040526 GCCTGGCCTCTCCCTGCTCCTGG - Intergenic
1101725654 12:107386093-107386115 AGCTGTTCTCTCCTGCCTCAGGG + Intronic
1102007322 12:109597001-109597023 GCCAGGCCTCTCCCTCCTCCAGG + Exonic
1102942400 12:116954978-116955000 GCTCGTCCTCTCCAGCCTCTTGG + Intronic
1103911809 12:124356083-124356105 GCCTGCTCTCTCCTGCCTCTGGG + Intronic
1104192798 12:126499443-126499465 GCCTGGCCTCTCTTGCATCATGG - Intergenic
1104755220 12:131264907-131264929 CGCTGGCCTCTCCCGCCTCTTGG - Intergenic
1104946381 12:132416688-132416710 GCCTGAGCTCTCCTTCCTCAGGG - Intergenic
1105280354 13:18959528-18959550 GCCTGGCCTCCCCCTCCTGAAGG + Intergenic
1105632724 13:22187067-22187089 GCCTGTCCTTTCCTATCTCAGGG + Intergenic
1106379451 13:29222798-29222820 GCCTGACCTCTCCCCTCTCCTGG + Intronic
1106476746 13:30105535-30105557 GCCTGTTCTCTCGGGCCTGAAGG - Intergenic
1107699910 13:43036904-43036926 GCCTGGCCTCTCCCGACTCACGG - Intronic
1108559501 13:51628381-51628403 CCCTGGCCTCTCCCACCTCCTGG - Intronic
1108599202 13:51975847-51975869 GCCTTTCCCCTCCCGCCCCTCGG - Intronic
1109396588 13:61766607-61766629 GCCTGGCCTCTCCCCGCTCCTGG - Intergenic
1109470563 13:62799168-62799190 GCCTAGCCTCTCCCGACTCCTGG + Intergenic
1109478762 13:62919749-62919771 GCCTGGCCTCTCCCTGCTCCTGG - Intergenic
1110239829 13:73254789-73254811 GGCTTTCCTCTCCAGCCTCCTGG + Intergenic
1110777911 13:79432158-79432180 GCCTGGCCTCTCCAGACTCCTGG + Intergenic
1113649811 13:112027384-112027406 GCCTGTCCCCACCCGACTCCTGG - Intergenic
1114177718 14:20338164-20338186 GCCTGTCCTTTGCTGCCTTAGGG - Intergenic
1114564863 14:23623202-23623224 GCCTGTCTTGTCCTGCCGCAAGG - Intergenic
1116167189 14:41349534-41349556 GCCTGGCCTCTCCCTGCTCCTGG + Intergenic
1116221756 14:42096412-42096434 GCCTGGCCTCTCCCAGCTCCTGG - Intergenic
1116902173 14:50371846-50371868 GCCTGACCTCTCCCCACTCCTGG + Intronic
1118522236 14:66597538-66597560 GCCTGGCCTCTCCCCACTCCTGG - Intronic
1119027304 14:71164338-71164360 GCTTGTCCTCTCCCGACTAAGGG + Intergenic
1119415576 14:74467301-74467323 CCCTGTCCTCTCCAGCATAAGGG + Intergenic
1119723764 14:76909318-76909340 CCCAGTCCTCACCCTCCTCAGGG - Intergenic
1119780005 14:77271089-77271111 GCCTTTTCTCTCCCGCGCCAGGG - Exonic
1120179009 14:81324261-81324283 GCCTGGCCTCTCCCTCCTCCTGG - Intronic
1120952047 14:90050582-90050604 ACCTGTCCTGCCCTGCCTCATGG + Intergenic
1121810283 14:96880696-96880718 CCCAGTGCTCTCCTGCCTCAAGG + Intronic
1121974016 14:98385750-98385772 GCCTGGCCTCTCTCCGCTCAGGG + Intergenic
1122088829 14:99324729-99324751 GCCTGTGCTCTCCCTCCCCCAGG - Intergenic
1122491160 14:102116974-102116996 GCCTGGCCTCTCCCCACTCCTGG + Intronic
1202940758 14_KI270725v1_random:143412-143434 GCCTGGTCTCTCCCACCTCCTGG + Intergenic
1124041738 15:26111706-26111728 GCATGCCCTCTCCTGCCCCACGG + Intergenic
1125114143 15:36068097-36068119 GCCTGGCCTCTCCCTACTCCCGG - Intergenic
1125241483 15:37582114-37582136 GCCTGGCCTCTCCCCACTCCCGG + Intergenic
1125764151 15:42121902-42121924 GCCTGTCCTCACCCAGATCAGGG + Intergenic
1126102922 15:45130270-45130292 GCCTGTCCTCTGCCCAATCAAGG + Intronic
1126215137 15:46146058-46146080 GCCTGGCCTCTCCCAACTCCTGG + Intergenic
1128756281 15:70185984-70186006 GCCTGGCCTCTCCTGCCTAATGG - Intergenic
1129183472 15:73891648-73891670 GCCTGGCCTCTCCCCACTCCTGG + Intergenic
1129300736 15:74624085-74624107 GCGTGTCCTCTGAGGCCTCAGGG - Intronic
1129660063 15:77548466-77548488 GCCTCTCCTCTCCCGTCTGAGGG - Intergenic
1130283887 15:82540131-82540153 TCCTGTCCTCTCCACCCGCAGGG - Exonic
1131759908 15:95611127-95611149 GCCTGACCTCTCTGGCCTCTGGG - Intergenic
1132584742 16:701192-701214 GCCTGTCCCCTCCCTCCTGTGGG - Intronic
1132625240 16:888496-888518 GCCTGTCCTCTCTCTCCACTTGG - Intronic
1133732570 16:8589707-8589729 GCCAGTCCTCTCCAGCCGCTCGG + Exonic
1135156948 16:20060815-20060837 ACCAGTCCCCTCCTGCCTCAGGG + Intronic
1135208169 16:20499874-20499896 GCCTGGCCTCTCCCCACTCCTGG + Intergenic
1135210730 16:20523826-20523848 GCCTGGCCTCTCCCCACTCCTGG - Intergenic
1135285392 16:21188616-21188638 GCATGTCCTCTCCAGCCTGGAGG - Intergenic
1135408587 16:22216119-22216141 GCTTGTCCTCTACAGCCGCATGG - Intronic
1138033616 16:53580463-53580485 GCCTGGCCTCTCCCTGCTCACGG - Intergenic
1138455167 16:57116831-57116853 TCCTCTCCTCTCCTGCCTCTAGG - Intronic
1138715376 16:59016264-59016286 GCCTGTGCTCCACTGCCTCAGGG - Intergenic
1139318198 16:66091395-66091417 GCCTGTCTTCCCCCACCTCCAGG + Intergenic
1139482900 16:67240648-67240670 GGCTCTCCTCCCCCGCCACAAGG + Intronic
1140999392 16:80294408-80294430 GCCTGTCCTTTCCTTCCCCATGG + Intergenic
1141316726 16:82969389-82969411 CCCTGATCTCTCCCACCTCAAGG + Intronic
1142132635 16:88437919-88437941 GCCTGTCCTCGCCGGGCCCAGGG - Exonic
1142309014 16:89301404-89301426 GTCTGTCCTCTACCACCTCAAGG - Intronic
1143118680 17:4594519-4594541 TCCTGTCCTCTCCCTCCTGCCGG - Intronic
1143125026 17:4636506-4636528 ACCTGTCCTCTCCATCCTGATGG + Intronic
1143423233 17:6812554-6812576 GCCTCCCGTCTCCTGCCTCAGGG + Intronic
1143708154 17:8714882-8714904 GCTTGTTCTCTCCAGCCTCATGG - Intergenic
1144807001 17:17974646-17974668 GTCTGTTCTCTCCCACCTAAAGG + Intronic
1145977442 17:28992618-28992640 GCCTGACCTGACCCGCCCCAGGG + Intronic
1146359079 17:32159569-32159591 GCCTGGCCTCTCCCTGCTCCTGG + Intronic
1146668033 17:34717649-34717671 TCCTGTCCCCTCCCGCCCCAGGG + Intergenic
1147679066 17:42228101-42228123 ACATGTCCTTTCCAGCCTCAAGG + Intronic
1147971387 17:44220349-44220371 GCCAGCTCTCTCCCGCCTCCCGG + Intronic
1148207320 17:45787238-45787260 GTCTGTCTTCTCCTGACTCATGG - Intronic
1148584938 17:48770797-48770819 GCCTGTAATCTCCTGCCTCCTGG + Intronic
1148986853 17:51630043-51630065 GCCTGTGCTCTCCCCCTTCCAGG + Intergenic
1149626278 17:58083139-58083161 GCCTGGCCTCTCCAGCCCCGGGG + Intergenic
1150520951 17:65866182-65866204 GCCTGGCCTCTCCCTGCTCCCGG + Intronic
1151464825 17:74277678-74277700 ACCTACCCTCTCCCGCCTCCAGG - Intronic
1152523326 17:80873014-80873036 GCCTGACTTCTCCCTGCTCATGG + Intronic
1152563430 17:81089799-81089821 GCCTGCCCTCTCCGCCCACATGG - Intronic
1152785441 17:82245647-82245669 GCCTTGCCACTCCTGCCTCACGG + Intronic
1152799361 17:82323737-82323759 GCCTCTTCTCCCCCGACTCAGGG - Intronic
1152848034 17:82614338-82614360 GGCTGTCCTGTCCCGACACAGGG + Intronic
1152848043 17:82614374-82614396 GGCTGTCCTGTCCCGACACAGGG + Intronic
1152878945 17:82804508-82804530 GCCTGGCCACTGCCGTCTCAAGG + Intronic
1153943934 18:10002463-10002485 GCCTGTCCTCTCTCACCCCATGG + Intergenic
1154290511 18:13102308-13102330 GCCTGTCCATTCTCGCCTCTCGG + Intronic
1156160268 18:34350826-34350848 GCCTGGCCTCTCCCAGCTCCTGG + Intergenic
1156244505 18:35284623-35284645 GCCTGGCCTCTCCCTGCTCCTGG - Intronic
1157125784 18:44954483-44954505 ACCTGTCCTCTCCCTTCCCAGGG + Intronic
1157506585 18:48230863-48230885 GCCTGGCCTCTCCCTGCTCCTGG + Intronic
1157604989 18:48920766-48920788 GCCCCTCCTCTCCCTCATCAAGG - Exonic
1157613771 18:48975487-48975509 GCCTGTCCCCTCCCCCATCGCGG + Intergenic
1158960476 18:62583928-62583950 GCCTGTCCTCTCTCTGCACAGGG - Intronic
1160148205 18:76380931-76380953 GCCTTTGCTCACCCGCCTCTGGG - Intronic
1160459354 18:79026322-79026344 GCCTGTATTCTCCAGCCTAAGGG + Intergenic
1161346413 19:3770767-3770789 GCCAGGCCTCCCCCGCCTCCTGG - Exonic
1161582540 19:5088629-5088651 GCCTGTCCCCTGCAGCCTCAGGG - Intronic
1161963260 19:7534406-7534428 GCCGGTCCTCTTCCACCTCAGGG - Exonic
1162138767 19:8572619-8572641 GCCTTTCCTGTCCATCCTCATGG + Intronic
1164939744 19:32243403-32243425 GCCTTTCCTCTCCCCTCTCCAGG + Intergenic
1167005688 19:46775199-46775221 GCCTGGCCTCCCCTGTCTCAGGG - Exonic
1167106981 19:47436145-47436167 CCCTGTCTTCTCCCTCCTCCTGG + Intronic
1167254386 19:48418577-48418599 GCCTCTCCTCTCCATTCTCATGG - Intronic
1167605925 19:50481230-50481252 TCCCTTCCTCTCCAGCCTCATGG - Intronic
1168103050 19:54151293-54151315 TCCTGTCCTCACCAGCCCCAGGG - Intronic
926583321 2:14656288-14656310 TCCTGTTCTCTCCACCCTCAGGG - Intergenic
926838876 2:17056439-17056461 GCCTCTCCTCTCCTGCTGCAGGG + Intergenic
926953757 2:18271862-18271884 GCCTGGCCTCTCCCAACTCCTGG - Intronic
929592826 2:43158167-43158189 GCATGTCCTATCCTGCCTCCTGG + Intergenic
929778283 2:44942003-44942025 CCCTCTCCTCTCCCTCCTCCTGG + Exonic
930957182 2:57217148-57217170 GCCTGGCCTCTCCCTCCTCCTGG + Intergenic
931734020 2:65177842-65177864 GCCTGGCCTCTCCCCACTCCTGG - Intergenic
932496887 2:72149845-72149867 GCCCGTCTTCTCCCGCCTCTGGG - Intergenic
932732642 2:74231979-74232001 GCCTCTTCTCTCACGCCCCATGG - Intronic
933383669 2:81583477-81583499 GCCTGGCCTCTCTCGGCTCCCGG + Intergenic
934030610 2:88042457-88042479 GCCTCTGCACTCCAGCCTCAGGG - Intronic
935579386 2:104743693-104743715 GCCTTTTCTCTCCCTCCTCTGGG - Intergenic
937973979 2:127569976-127569998 GCCTATCCTGTCCCTCCCCATGG - Intronic
938096509 2:128467465-128467487 GCCTGGCCTCTCCTGACTCCTGG - Intergenic
938722155 2:134076526-134076548 GCCTGGCCTCTCCCCACTCCCGG - Intergenic
939837606 2:147150055-147150077 GCCTGGCCTCTCCCCACTCCTGG + Intergenic
940422904 2:153499784-153499806 GCCTGGCCTCTCCCAGCTCCAGG - Intergenic
942249274 2:174033850-174033872 GCCTGTCCTCTCCATCCTGGTGG - Intergenic
944901901 2:204223851-204223873 GCCTGGCCTCTCCCTGCTCCTGG - Intergenic
944980123 2:205108041-205108063 GCCTATCCTCTCCTGTGTCAAGG + Intronic
945681959 2:212925001-212925023 GCCTTTCCTCTTCCTGCTCATGG + Intergenic
946290129 2:218738263-218738285 GCCTGGCCTCTGCCATCTCAGGG + Exonic
946297124 2:218794120-218794142 GCTTGTCCTCTCCCGTACCAGGG - Intronic
947531143 2:230909277-230909299 TCCTTTCCTCTCCCCCCTCATGG + Exonic
948551509 2:238775829-238775851 GCCTGTCCAATCCGGCCTCTGGG - Intergenic
948789227 2:240368780-240368802 GCCTGTCCTCTCGTGCCCCCAGG - Intergenic
1169029078 20:2394431-2394453 CCCTGTCCTCTCCCCACCCAGGG + Exonic
1170570937 20:17632253-17632275 TCCTGTCCTCTCCAGACTCAGGG - Intronic
1170851646 20:20009980-20010002 GCCTGTGCTCTGACGGCTCAGGG + Intergenic
1171236994 20:23535207-23535229 GCCTGGCCTCTCCCCGCTCCTGG - Intergenic
1171343366 20:24447399-24447421 GCCTGTAGTCTCCCACCTCATGG - Intergenic
1171536669 20:25898759-25898781 GCCTGGCCTCTCCCACCTCCTGG + Intergenic
1171804439 20:29662398-29662420 GCCTGGTCTCTCCCACCTCCTGG - Intergenic
1171839607 20:30194024-30194046 GCCTGGTCTCTCCCACCTCCTGG + Intergenic
1172133650 20:32673108-32673130 TCCTCTCCTCACCCGCCCCAGGG - Intergenic
1173160509 20:40648689-40648711 TCCTGTCCTCTCCCTGCTGATGG + Intergenic
1175208413 20:57329731-57329753 GCCTGTCCAGCCCCGCCTCTGGG + Intergenic
1175545711 20:59776487-59776509 TCCTGTCCTCACCAGCCACACGG + Intronic
1176153298 20:63604592-63604614 GCCTGGCCTCTCACTCCTAAGGG + Intronic
1176219470 20:63963235-63963257 GGCTGCCTTCTCCAGCCTCATGG - Exonic
1176273426 20:64248341-64248363 GCCTGGTCTCTCTCGCCTCCGGG - Intergenic
1176582396 21:8543530-8543552 GCCTGGTCTCTCCCACCTCCTGG - Intergenic
1177344719 21:19854243-19854265 GCCTGGCCTCTCCCCACTCCCGG - Intergenic
1178305447 21:31486923-31486945 GCCTGTCCTCTCCTGACCCTAGG - Intronic
1179646304 21:42778402-42778424 GCCCGTCGTCTCCTGGCTCAGGG - Intergenic
1179812726 21:43882845-43882867 GCCTGTTGTCTCCATCCTCAGGG + Intronic
1179909585 21:44440922-44440944 GCCTCCCCACTCCCGCCTCCAGG - Intronic
1180265230 22:10520578-10520600 GCCTGGTCTCTCCCACCTCCTGG - Intergenic
1181589921 22:23877700-23877722 GCCTCTCCTCTGCCTCCTTAGGG + Exonic
1182012389 22:27011727-27011749 ACATGGCCTCTCCTGCCTCAGGG + Intergenic
1183678576 22:39313540-39313562 TCCTTTCCTCTCCCACCACAGGG + Intronic
1184235445 22:43180702-43180724 GCCTGTCCTCCCCCTCCCCGGGG + Intronic
1184766818 22:46576661-46576683 GCCTTTCCTCGACCGCCTCGCGG - Intronic
1184864137 22:47193065-47193087 GCCTGGCCACTCCAGCCTCGCGG + Intergenic
950044945 3:9943521-9943543 ACCTCCCCTCTCCCGCCCCAGGG - Intronic
950994385 3:17480022-17480044 GCCTGGCCTCTCCCTGCTCCTGG + Intronic
951054237 3:18128799-18128821 CTCTGTCCTCTTCCTCCTCAGGG - Intronic
952991892 3:38837533-38837555 GCCTGGCGTTTCCTGCCTCATGG + Intergenic
953414696 3:42708989-42709011 GCCTGTCTTCTGCTGCCGCAGGG + Exonic
953473416 3:43185405-43185427 GCCTGTCCTGACCTTCCTCAGGG - Intergenic
956462405 3:69485253-69485275 GCCTGGCCTCCCCCGACTCCTGG - Intronic
957678716 3:83404216-83404238 GCCTGGCCTCTCTCCCCTCCAGG + Intergenic
959111208 3:102124527-102124549 GCATGTTCTCTCCCTCCCCAGGG - Intronic
961059658 3:123817695-123817717 GCCTGTAATCACCAGCCTCATGG - Intronic
961449340 3:126995395-126995417 GCCTGTGCTCTCCCCTCCCATGG - Intronic
961477688 3:127158852-127158874 GCCTGCATGCTCCCGCCTCAAGG - Intergenic
963199103 3:142568733-142568755 GCCTGGCCTCTCCCCGCTCCCGG + Intronic
963250105 3:143095417-143095439 GCCTGGCCTCTCCCCGCTCCTGG + Intergenic
963906186 3:150775032-150775054 CCCTGGCCTCTCCCCCCTCCTGG - Intergenic
966966302 3:184998001-184998023 GCCAAGGCTCTCCCGCCTCATGG - Intronic
967077126 3:186013599-186013621 GCGTGTCCCCTCCCCCCCCAGGG - Intergenic
968382492 4:108168-108190 GCCTGTCGTCTCCCAGCACAGGG + Intergenic
968473035 4:790573-790595 GCCTGCCCTATCCTGCCTCTGGG + Intronic
968503368 4:961200-961222 GGCTGGCCTCTCCCGCCCCAGGG - Exonic
968503390 4:961262-961284 GGCTGGCCTCTCCCGCCCCAGGG - Intronic
968503412 4:961319-961341 GGCTGGCCTCTCCCGCCCCAGGG - Intronic
968503438 4:961381-961403 AGCTGGCCTCTCCCGCCCCAGGG - Intronic
968624357 4:1619868-1619890 AGCTGTCCTCTCTCGCCTCATGG + Intronic
969398793 4:6939909-6939931 GCCAGTCCCCGCCGGCCTCAGGG - Intronic
971501172 4:27319299-27319321 GCCTTTCCTCTCTAGACTCAAGG + Intergenic
972574021 4:40335340-40335362 GCCTGAGCTCTCCCGCCATAAGG + Exonic
972782033 4:42294622-42294644 GCCTGTCCCCTACCCCCACAAGG - Intergenic
972997187 4:44895364-44895386 GCATGCTCTCTCCCTCCTCAGGG - Intergenic
973041063 4:45471476-45471498 GCCTGGCCTCTCCCCACTCCTGG + Intergenic
974023357 4:56711223-56711245 GCCTGGCCTCTCCCCACTCCTGG + Intergenic
974075741 4:57166729-57166751 GTCTGTCCTCTTCAGCCTCAGGG + Intergenic
974697862 4:65398179-65398201 GCCTGGCCTCTCCCTGCTCCTGG + Intronic
974787385 4:66636737-66636759 GCCAGTCCTCCCCCGGCCCAGGG - Intergenic
978248651 4:106604652-106604674 ACCTGGCCTCTCCCCACTCATGG - Intergenic
978498399 4:109384283-109384305 GCCTGGCCTCTCCCTGCTCCCGG + Intergenic
979084618 4:116391052-116391074 GCCTGTCCACTTCCACCTGATGG + Intergenic
979685895 4:123510039-123510061 ACCTCTACTCTCCTGCCTCAGGG + Intergenic
979956074 4:126955582-126955604 GCCTGGCCTCTCCCTGCTCCCGG + Intergenic
980253704 4:130349734-130349756 GCCTGGCCTCTCCCCACTCCTGG - Intergenic
981727448 4:147862287-147862309 CCCTGGCCTCTCCCGGCTCCCGG - Intronic
982203064 4:152976729-152976751 GCCTGTCCTCTCCTGCCTCCTGG + Exonic
982545118 4:156724287-156724309 GCCTGGCCTCTCCCTGCTCCTGG + Intergenic
983069789 4:163254439-163254461 GCCTGGCCTCTCCCTGCTCCTGG - Intergenic
983491822 4:168398234-168398256 GCCTGGCCTCTCCCTGCTCCTGG + Intronic
984255139 4:177381874-177381896 GCCTGGCCTCTCCCCACTCCAGG - Intergenic
988524959 5:31978899-31978921 CCCTGTCCTCTCCAGCTTCCTGG - Intronic
989527458 5:42469469-42469491 GCAGGTCCTCTCCCACCACAAGG - Intronic
991590525 5:68246924-68246946 GCCTTTCCTCTCCCCTCTTAAGG - Intronic
993384920 5:87252089-87252111 GCCTGGCCTCTCCCCACTCCCGG - Intergenic
994944470 5:106368288-106368310 GGCTGTCCTCTCCCTCTTCAGGG - Intergenic
996613882 5:125416060-125416082 GCCTCTACTCTACAGCCTCAAGG - Intergenic
998696000 5:144640294-144640316 GCCTGTACTTTCTCACCTCAGGG - Intergenic
999166239 5:149551592-149551614 GCCTGTCCTCACCCCCGTCCCGG + Intergenic
999341692 5:150778789-150778811 TCCTGCGCTCTCCCGCCTCCCGG + Exonic
1000266202 5:159640748-159640770 GCCTGGCCTCTCCCAGCTCCTGG + Intergenic
1002080897 5:176736753-176736775 GTTTGTGCTCTCCCTCCTCAGGG - Intergenic
1005147437 6:22707568-22707590 GCCTTTCCTCTCTTGCCCCAGGG + Intergenic
1005972579 6:30773021-30773043 TCCTCTCCTCTCCCACCTCTGGG + Intergenic
1006146137 6:31960765-31960787 GCCTGGGCTCTTCCTCCTCAAGG - Intronic
1006302770 6:33202492-33202514 ACATGTCCTCTCCCTCCTGAGGG - Intronic
1007470915 6:42089642-42089664 CCCTGTCCACCCACGCCTCAGGG - Intergenic
1007667366 6:43523122-43523144 GTCTGGCCTCCCCAGCCTCAAGG - Exonic
1008330736 6:50241087-50241109 GCCTGGCCTCTCCCCACTCCCGG - Intergenic
1008449388 6:51632617-51632639 CCCTGTCCTCTGTGGCCTCATGG - Exonic
1009243448 6:61205325-61205347 GCCTGGCCTCTCCCTGCTCCTGG - Intergenic
1011228734 6:85136373-85136395 GCCTGTCCCCTCCCTCCTGCTGG - Intergenic
1012122299 6:95384111-95384133 GCCTGGCCTCTCCCCACTCCCGG + Intergenic
1012889848 6:104885644-104885666 GCCTGGCCTCTCCCCACTCCCGG + Intergenic
1017526206 6:155243306-155243328 TCCTGGCCTCTTCTGCCTCAGGG - Intronic
1018485560 6:164238050-164238072 GCCTGTCTTCCACCTCCTCAGGG + Intergenic
1019032350 6:169024269-169024291 GCCCGTCCTCACCCACCTCATGG - Intergenic
1019485272 7:1286301-1286323 GCCCGGCCCCTCCCACCTCAGGG - Intergenic
1019640885 7:2103091-2103113 GCGCGTCCTCTCCCACCTCAGGG + Intronic
1019798827 7:3072791-3072813 GTCTTTCCTCTTCTGCCTCAGGG - Intergenic
1020586684 7:10078688-10078710 GCCTGGCCTCTCCCCACTCTTGG + Intergenic
1023758788 7:43444714-43444736 GCCTGCCCTCTCCCTGCTCCAGG - Exonic
1023869639 7:44256123-44256145 GCCTCTCCTCTCACTCCTCATGG + Intronic
1024035285 7:45502981-45503003 GCCTGGCCTCTCCTGCTCCAGGG - Intergenic
1024794742 7:53007704-53007726 GCCTGACCTCTCCCCGCTCCTGG + Intergenic
1027198499 7:76047850-76047872 GCCCGTCCTCTTCCACCTCTTGG + Exonic
1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG + Intronic
1028111696 7:86949655-86949677 GCCTGGCCTCTCCCCACTCCTGG + Intronic
1028136680 7:87230272-87230294 GCCTGGCCTCGCCCTCCTCCTGG + Intergenic
1031743809 7:125468497-125468519 GCCTGACCTCTCCCTGCTCTTGG - Intergenic
1031837109 7:126691335-126691357 GCCTGGCCTCTCCCCACTCCCGG - Intronic
1032000634 7:128262924-128262946 GCTTGTCCTCTCTCGCTGCAGGG + Intergenic
1032202022 7:129828956-129828978 GCCTGCTCTCTCGGGCCTCAGGG - Intergenic
1032521727 7:132550654-132550676 CCCTGTCCTCCCCTCCCTCAAGG + Intronic
1033406043 7:141072722-141072744 GCCTGGGCTCTCGCGCCTCCCGG + Intergenic
1033685693 7:143639639-143639661 GCCTTTTCTCTCCCGCCTTGTGG + Intronic
1033690050 7:143727676-143727698 GCCTTTTCTCTCCCGCCTTGTGG - Intronic
1033698921 7:143817982-143818004 GCCTTTTCTCTCCCGCCTTGTGG - Intergenic
1034107685 7:148504504-148504526 GCCTGCCGGCTGCCGCCTCATGG - Intergenic
1036915540 8:12800063-12800085 GCCTGGCCTCTCCCTGCTCCTGG - Intergenic
1037348332 8:17923235-17923257 GCCGTTACTCTCCCGCCTCTGGG - Intronic
1037876755 8:22552305-22552327 GCCTCCCCTCTCCCGCTCCAGGG + Intronic
1041956266 8:63560203-63560225 GCCTGGCCTCTCCCCACTCCTGG - Intergenic
1043796587 8:84549460-84549482 CCTTGTCCTCTCCCACCTCCTGG - Intronic
1043798742 8:84579288-84579310 GCCTGTCCTCTGCCCACTCCTGG - Intronic
1045583266 8:103500964-103500986 GCCTGACCTCAGCCACCTCACGG + Intronic
1046503827 8:115111832-115111854 ACCTGGCCTCTCCCGACTCTTGG - Intergenic
1047603453 8:126450568-126450590 TGCTGTCTTCTCCAGCCTCATGG + Intergenic
1049122855 8:140755454-140755476 TACTGTCCTGCCCCGCCTCATGG + Intronic
1049654134 8:143790322-143790344 CCCTGGCCTCACCAGCCTCATGG + Intergenic
1049724777 8:144140656-144140678 GCCGGGCGTCTCCCGCCTCCAGG + Exonic
1050905251 9:10994843-10994865 GCCTTTCCTCTCCCACCATATGG + Intergenic
1051538824 9:18191342-18191364 GCCTGTCCTCCTCAGTCTCAAGG - Intergenic
1052044229 9:23775827-23775849 ACCTTTCTTCTCCTGCCTCATGG + Intronic
1053509808 9:38678110-38678132 GCCTGTCCCCACCCTCCTCATGG - Intergenic
1056042233 9:82680336-82680358 AGCTGTCCTCTCCCACCTCAGGG + Intergenic
1056565685 9:87770908-87770930 GCCAGTCCCCTCCCTCCCCAGGG + Intergenic
1056764705 9:89437552-89437574 GCCTGTGCCCTCCCCTCTCAGGG - Intronic
1058592335 9:106578264-106578286 GCCTGCCCTCTGTCACCTCAGGG - Intergenic
1059341779 9:113601434-113601456 GCCTGTCCTCTCCCTAGCCAGGG + Intergenic
1059512983 9:114866330-114866352 GCCTCTGCTCTTCTGCCTCAAGG - Intergenic
1060218340 9:121751714-121751736 GTCCCTCCTCTCTCGCCTCATGG - Intronic
1060301994 9:122379536-122379558 GCCAGTCCTGTGCAGCCTCATGG + Intronic
1060599881 9:124870395-124870417 GCCTGTCCCCTCCCCCCGCACGG + Intronic
1060758558 9:126229803-126229825 GCTAGTTCTCTCCTGCCTCAGGG - Intergenic
1061196748 9:129110817-129110839 GCCCCTCCTGTCCCTCCTCAAGG - Intronic
1061303743 9:129721106-129721128 GCCTGTTTTCTCCCGGCTCCAGG - Intronic
1061424551 9:130490895-130490917 GCCTGTCCTCCCACAGCTCAGGG - Intronic
1061774066 9:132948896-132948918 GCATGTCCTCTCCCTCCTCTTGG + Intronic
1062353378 9:136149949-136149971 GCCTGACCTGTCCCTCCTCCAGG + Intergenic
1062440653 9:136567839-136567861 GACTGCACTCTCCAGCCTCAGGG - Intergenic
1062488245 9:136791636-136791658 GCCTCTCCTGTCCCTCCTCTGGG - Intronic
1203612411 Un_KI270749v1:21544-21566 GCCTGGTCTCTCCCACCTCCTGG - Intergenic
1185446102 X:258676-258698 GCAGGTCCCCTCCCACCTCACGG - Intergenic
1186515585 X:10164261-10164283 TCCTGTCCTGCCCTGCCTCAGGG - Intronic
1199330031 X:146548774-146548796 CCCTGTCCTCTCCCATGTCATGG - Intergenic
1200000952 X:153059483-153059505 CCCTGTCATCTCCCAGCTCAGGG - Intronic
1200298868 X:154952161-154952183 CCCTCTTCTCTCCAGCCTCATGG - Intronic