ID: 1027255177

View in Genome Browser
Species Human (GRCh38)
Location 7:76426375-76426397
Sequence GCCTGTCCTCTCCCGCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 333}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027255161_1027255177 26 Left 1027255161 7:76426326-76426348 CCCAGCTAAACCCTGATCCCTGG No data
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255167_1027255177 9 Left 1027255167 7:76426343-76426365 CCCTGGACCAAGTTCCTGTGGTC 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255165_1027255177 15 Left 1027255165 7:76426337-76426359 CCTGATCCCTGGACCAAGTTCCT 0: 1
1: 0
2: 0
3: 9
4: 185
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255170_1027255177 2 Left 1027255170 7:76426350-76426372 CCAAGTTCCTGTGGTCCCATGGA 0: 1
1: 0
2: 1
3: 11
4: 155
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255163_1027255177 25 Left 1027255163 7:76426327-76426349 CCAGCTAAACCCTGATCCCTGGA 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255168_1027255177 8 Left 1027255168 7:76426344-76426366 CCTGGACCAAGTTCCTGTGGTCC No data
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255164_1027255177 16 Left 1027255164 7:76426336-76426358 CCCTGATCCCTGGACCAAGTTCC 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255160_1027255177 27 Left 1027255160 7:76426325-76426347 CCCCAGCTAAACCCTGATCCCTG No data
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333
1027255173_1027255177 -5 Left 1027255173 7:76426357-76426379 CCTGTGGTCCCATGGAGGGCCTG 0: 1
1: 0
2: 4
3: 10
4: 224
Right 1027255177 7:76426375-76426397 GCCTGTCCTCTCCCGCCTCAGGG 0: 1
1: 0
2: 4
3: 39
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027255177 Original CRISPR GCCTGTCCTCTCCCGCCTCA GGG Intronic