ID: 1027260631

View in Genome Browser
Species Human (GRCh38)
Location 7:76462087-76462109
Sequence GACAGGGTGCCGGGTGCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027260618_1027260631 27 Left 1027260618 7:76462037-76462059 CCTGAGGGCGAGAGTTGGGGGAC 0: 2
1: 1
2: 2
3: 17
4: 212
Right 1027260631 7:76462087-76462109 GACAGGGTGCCGGGTGCGAAAGG No data
1027260626_1027260631 -6 Left 1027260626 7:76462070-76462092 CCGGCAGCTTTGGACGGGACAGG 0: 2
1: 0
2: 0
3: 3
4: 126
Right 1027260631 7:76462087-76462109 GACAGGGTGCCGGGTGCGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027260631 Original CRISPR GACAGGGTGCCGGGTGCGAA AGG Intronic
No off target data available for this crispr