ID: 1027261258

View in Genome Browser
Species Human (GRCh38)
Location 7:76466043-76466065
Sequence GGGGAAAAGGAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1027261252_1027261258 -4 Left 1027261252 7:76466024-76466046 CCGCCTGGGGGAAATCCAGGGGG 0: 2
1: 0
2: 1
3: 13
4: 144
Right 1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG No data
1027261254_1027261258 -7 Left 1027261254 7:76466027-76466049 CCTGGGGGAAATCCAGGGGGAAA 0: 2
1: 0
2: 3
3: 21
4: 247
Right 1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1027261258 Original CRISPR GGGGAAAAGGAGAATGAGGA AGG Intronic
No off target data available for this crispr